Gene Page:CASK

Summary?
GeneID 8573
Symbol CASK
Synonyms CAGH39|CAMGUK|CMG|FGS4|LIN2|MICPCH|MRXSNA|TNRC8
Description calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Reference MIM:300172|HGNC:HGNC:1497|Ensembl:ENSG00000147044|HPRD:02164|Vega:OTTHUMG00000021378
Gene type protein-coding
Map location Xp11.4
Fetal beta 1.432
Support PROTEIN CLUSTERING
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
Ascano FMRP targets
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统的搜索PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Expression Meta-analysis of gene expression Pvalue: 1.461
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.1861

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
KIAA1305 0.97 0.95
PLXNB2 0.97 0.97
PLEKHG2 0.97 0.92
PLXNA3 0.97 0.93
KDM6B 0.95 0.93
GTF2IRD1 0.95 0.89
CELSR3 0.94 0.84
AD000671.1 0.94 0.89
CASP2 0.94 0.85
ZNF646 0.94 0.89
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
C5orf53 -0.69 -0.81
FBXO2 -0.67 -0.65
HLA-F -0.67 -0.69
ACOT13 -0.66 -0.77
ALDOC -0.66 -0.64
ACYP2 -0.65 -0.73
S100B -0.65 -0.77
AIFM3 -0.65 -0.63
CA4 -0.65 -0.76
LDHD -0.65 -0.61

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0005515 protein binding IEA -
GO:0005516 calmodulin binding IEA -
GO:0005524 ATP binding IEA -
GO:0004385 guanylate kinase activity TAS 9660868
GO:0004674 protein serine/threonine kinase activity IEA -
GO:0016740 transferase activity IEA -
GO:0016301 kinase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007155 cell adhesion TAS 9660868
GO:0006468 protein amino acid phosphorylation IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -
GO:0005886 plasma membrane TAS 9660868
GO:0015629 actin cytoskeleton TAS 9660868

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
APBA1 D9S411E | MINT1 | X11 | X11A | X11ALPHA amyloid beta (A4) precursor protein-binding, family A, member 1 X11-ALPHA interacts with Lin-2. BIND 9822620
APBA1 D9S411E | MINT1 | X11 | X11A | X11ALPHA amyloid beta (A4) precursor protein-binding, family A, member 1 - HPRD,BioGRID 9753324|9822620
|9952408|9822620|9952408
ATP2B4 ATP2B2 | DKFZp686G08106 | DKFZp686M088 | MXRA1 | PMCA4 | PMCA4b | PMCA4x ATPase, Ca++ transporting, plasma membrane 4 - HPRD,BioGRID 12511555
C16orf70 C16orf6 | FLJ12076 | LIN10 | lin-10 chromosome 16 open reading frame 70 Reconstituted Complex BioGRID 9822620
CACNA1B BIII | CACNL1A5 | CACNN | Cav2.2 calcium channel, voltage-dependent, N type, alpha 1B subunit The SH3 domain of CASK interacts with the carboxy-terminal proline-rich region (PRR) of Ca-alpha-1B. BIND 10455105
CADM1 BL2 | DKFZp686F1789 | IGSF4 | IGSF4A | MGC149785 | MGC51880 | NECL2 | Necl-2 | RA175 | ST17 | SYNCAM | TSLC1 | sTSLC-1 | sgIGSF | synCAM1 cell adhesion molecule 1 - HPRD,BioGRID 12202822
CASKIN1 ANKS5A CASK interacting protein 1 - HPRD 12040031
CD2AP CMS | DKFZp586H0519 CD2-associated protein Reconstituted Complex BioGRID 15331416
CNTNAP2 AUTS15 | CASPR2 | CDFE | DKFZp781D1846 | NRXN4 contactin associated protein-like 2 - HPRD,BioGRID 12093160
CNTNAP4 CASPR4 | KIAA1763 contactin associated protein-like 4 - HPRD,BioGRID 12093160
DFNB31 CIP98 | DKFZp434N014 | KIAA1526 | RP11-9M16.1 | USH2D | WHRN | WI deafness, autosomal recessive 31 - HPRD,BioGRID 12641734
DLG1 DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlg discs, large homolog 1 (Drosophila) Affinity Capture-Western
in vitro
in vivo
Reconstituted Complex
Two-hybrid		 BioGRID 10993877|12151521
|12351654|14960569
DLG1 DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlg discs, large homolog 1 (Drosophila) CASK interacts with DLG1 (SAP97). BIND 15729360
DLG1 DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlg discs, large homolog 1 (Drosophila) - HPRD 10993877|12351654
DLG4 FLJ97752 | FLJ98574 | PSD95 | SAP90 discs, large homolog 4 (Drosophila) - HPRD,BioGRID 12151521
EPB41 4.1R | EL1 | HE erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) - HPRD,BioGRID 9660868
F11R CD321 | JAM | JAM-1 | JAM-A | JAM1 | JAMA | JCAM | KAT | PAM-1 F11 receptor - HPRD,BioGRID 11120739
FCHSD2 KIAA0769 | NWK | SH3MD3 FCH and double SH3 domains 2 - HPRD,BioGRID 14627983
GRIK2 EAA4 | GLR6 | GLUK6 | GLUR6 | MGC74427 | MRT6 glutamate receptor, ionotropic, kainate 2 - HPRD 12151522
ID1 ID | bHLHb24 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein CASK interacts with Id1. BIND 15694377
ID1 ID | bHLHb24 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein CASK interacts with Id1'. BIND 15694377
ID1 ID | bHLHb24 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein Reconstituted Complex
Two-hybrid		 BioGRID 15694377
KCNJ12 FLJ14167 | IRK2 | KCNJN1 | Kir2.2 | Kir2.2v | hIRK | hIRK1 | hkir2.2x | kcnj12x potassium inwardly-rectifying channel, subfamily J, member 12 - HPRD,BioGRID 14960569|15024025
KCNJ4 HIR | HIRK2 | HRK1 | IRK3 | Kir2.3 | MGC142066 | MGC142068 potassium inwardly-rectifying channel, subfamily J, member 4 - HPRD 11742811
KCNJ4 HIR | HIRK2 | HRK1 | IRK3 | Kir2.3 | MGC142066 | MGC142068 potassium inwardly-rectifying channel, subfamily J, member 4 Affinity Capture-Western BioGRID 14960569|15024025
LIN7A LIN-7A | LIN7 | MALS-1 | MGC148143 | TIP-33 | VELI1 lin-7 homolog A (C. elegans) Affinity Capture-Western
in vitro
in vivo
Reconstituted Complex		 BioGRID 9753324|9822620
|14960569
LIN7A LIN-7A | LIN7 | MALS-1 | MGC148143 | TIP-33 | VELI1 lin-7 homolog A (C. elegans) - HPRD 9753324|9822620|9952408
LIN7B LIN-7B | MALS-2 | MALS2 | VELI2 lin-7 homolog B (C. elegans) - HPRD 11742811
LIN7B LIN-7B | MALS-2 | MALS2 | VELI2 lin-7 homolog B (C. elegans) Affinity Capture-Western BioGRID 14960569
LIN7C FLJ11215 | LIN-7-C | LIN-7C | MALS-3 | MALS3 | VELI3 lin-7 homolog C (C. elegans) Affinity Capture-Western BioGRID 14960569
NPHS1 CNF | NPHN nephrosis 1, congenital, Finnish type (nephrin) Affinity Capture-MS
Reconstituted Complex		 BioGRID 15331416
NRXN1 DKFZp313P2036 | FLJ35941 | Hs.22998 | KIAA0578 neurexin 1 - HPRD,BioGRID 11036064
NRXN1 DKFZp313P2036 | FLJ35941 | Hs.22998 | KIAA0578 neurexin 1 - HPRD 8786425
NRXN2 FLJ40892 | KIAA0921 neurexin 2 - HPRD 8786425
NRXN3 KIAA0743 | MGC176711 neurexin 3 - HPRD,BioGRID 8786425
PARK2 AR-JP | LPRS2 | PDJ | PRKN Parkinson disease (autosomal recessive, juvenile) 2, parkin - HPRD,BioGRID 11679592
RAB3A - RAB3A, member RAS oncogene family - HPRD 11377421
RPH3A KIAA0985 rabphilin 3A homolog (mouse) - HPRD,BioGRID 11377421
SDC1 CD138 | SDC | SYND1 | syndecan syndecan 1 - HPRD,BioGRID 9660868
SDC2 HSPG | HSPG1 | SYND2 syndecan 2 - HPRD,BioGRID 9660868
SDC3 N-syndecan | SDCN | SYND3 syndecan 3 - HPRD 10460248
TANC1 KIAA1728 | ROLSB | TANC tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 - HPRD 15673434
TBR1 MGC141978 | TES-56 T-box, brain, 1 - HPRD,BioGRID 10749215
TSPYL2 CDA1 | CINAP | CTCL | DENTT | HRIHFB2216 | SE20-4 TSPY-like 2 Affinity Capture-Western
Two-hybrid		 BioGRID 15066269


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG TIGHT JUNCTION 134 86 All SZGR 2.0 genes in this pathway
PID SYNDECAN 1 PATHWAY 46 29 All SZGR 2.0 genes in this pathway
PID SYNDECAN 2 PATHWAY 33 27 All SZGR 2.0 genes in this pathway
PID SYNDECAN 3 PATHWAY 17 15 All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA UP 294 178 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN 352 225 All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP 269 146 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP 501 327 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR UP 162 116 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP 137 84 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375 806 All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN 781 465 All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP 177 113 All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS UP 126 72 All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 UP 120 73 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN 394 258 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN 483 336 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
MANALO HYPOXIA UP 207 145 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 AND CD2 UP 89 51 All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS RESPONSE 35 28 All SZGR 2.0 genes in this pathway
ULE SPLICING VIA NOVA2 43 38 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR UP 156 101 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR UP 101 69 All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP 280 183 All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN 220 147 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP 973 570 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP 863 514 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN 315 197 All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871 505 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D DN 78 34 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN 366 257 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP 491 316 All SZGR 2.0 genes in this pathway
SYED ESTRADIOL RESPONSE 19 15 All SZGR 2.0 genes in this pathway
PYEON CANCER HEAD AND NECK VS CERVICAL UP 193 95 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN UP 56 38 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR UP 55 41 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177 132 All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP 387 225 All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A 770 480 All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN 784 464 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B 517 302 All SZGR 2.0 genes in this pathway

部分VI. microRNA注释

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-146 207 213 m8 hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU
hsa-miR-146bbrain UGAGAACUGAAUUCCAUAGGCU
miR-196 98 105 1A,m8 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGG
hsa-miR-196b UAGGUAGUUUCCUGUUGUUGG
miR-369-3p 247 253 m8 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
miR-370 76 82 m8 hsa-miR-370brain GCCUGCUGGGGUGGAACCUGG
miR-410 269 275 m8 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-495 57 63 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
miR-543 265 272 1A,m8 hsa-miR-543 AAACAUUCGCGGUGCACUUCU