Gene Page:TP63
Summary?
GeneID | 8626 |
Symbol | TP63 |
Synonyms | AIS|B(p51A)|B(p51B)|EEC3|KET|LMS|NBP|OFC8|RHS|SHFM4|TP53CP|TP53L|TP73L|p40|p51|p53CP|p63|p73H|p73L |
Description | 肿瘤的p63蛋白 |
Reference | MIM:603273|HGNC:HGNC:15979|Ensembl:ENSG00000073282|HPRD:04469|Vega:OTTHUMG00000156313 |
Gene type | protein-coding |
Map location | 3q28 |
Pascal p-value | 0.429 |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
CV:PheWAS | Phenome-wide association studies (PheWAS) | 157 SNPs associated with schizophrenia | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0143 |
Section I. Genetics and epigenetics annotation
CV:PheWAS
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|---|---|---|---|---|---|---|
rs10937405 | 3 | 189383183 | null | 1.465 | TP63 | null |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/TP63_DE_GTEx.png)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
去:0003700 | transcription factor activity | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0016564 | transcription repressor activity | IDA | 12446784 | |
GO:0016563 | transcription activator activity | IDA | 12446784 | |
GO:0016563 | transcription activator activity | NAS | 9774969 | |
GO:0042802 | identical protein binding | 新闻学会 | 12446779 | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0002347 | response to tumor cell | IEA | - | |
GO:0006917 | induction of apoptosis | TAS | 9662378 | |
GO:0006915 | apoptosis | IDA | 9774969 | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0051289 | protein homotetramerization | 新闻学会 | 10373484 | |
GO:0030308 | negative regulation of cell growth | IEA | - | |
GO:0045747 | positive regulation of Notch signaling pathway | IDA | 11641404 | |
GO:0045892 | negative regulation of transcription, DNA-dependent | IDA | 12446784 | |
GO:0045893 | positive regulation of transcription, DNA-dependent | IDA | 12446784 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005856 | cytoskeleton | IDA | 18029348 | |
GO:0005634 | nucleus | IDA | 12446779 | |
GO:0005634 | nucleus | NAS | 9774969 | |
GO:0005737 | cytoplasm | IDA | 10657951 | |
GO:0005925 | focal adhesion | IDA | 18029348 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0基因通路 | Info |
---|---|---|---|
PID P73PATHWAY | 79 | 59 | All SZGR 2.0 genes in this pathway |
PID P53 DOWNSTREAM PATHWAY | 137 | 94 | All SZGR 2.0 genes in this pathway |
PID DELTA NP63 PATHWAY | 47 | 34 | All SZGR 2.0 genes in this pathway |
PID TAP63 PATHWAY | 54 | 40 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
SCHUETZ BREAST CANCER DUCTAL INVASIVE DN | 84 | 53 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS DN | 182 | 111 | All SZGR 2.0 genes in this pathway |
DEURIG T细胞专业MPHOCYTIC LEUKEMIA UP | 368 | 234 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
WANG CLIM2 TARGETS UP | 269 | 146 | All SZGR 2.0 genes in this pathway |
JAEGER METASTASIS DN | 258 | 141 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS DN | 139 | 76 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 4 5WK UP | 271 | 175 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
XU HGF TARGETS REPRESSED BY AKT1 DN | 95 | 58 | All SZGR 2.0 genes in this pathway |
SIMBULAN UV RESPONSE NORMAL DN | 33 | 27 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 12HR UP | 116 | 79 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 60 MCF10A | 39 | 24 | All SZGR 2.0 genes in this pathway |
AMIT SERUM RESPONSE 40 MCF10A | 32 | 21 | All SZGR 2.0 genes in this pathway |
KAUFFMANN DNA REPAIR GENES | 230 | 137 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 1 DN | 169 | 102 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 3 DN | 59 | 32 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
NGUYEN NOTCH1 TARGETS DN | 86 | 67 | All SZGR 2.0 genes in this pathway |
CROMER METASTASIS DN | 81 | 58 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV SCC DN | 123 | 86 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
DAZARD UV RESPONSE CLUSTER G6 | 153 | 112 | All SZGR 2.0 genes in this pathway |
霁CARCINOGENESIS BY KRAS AND STK11 UP | 12 | 7 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
SARRIO EPITHELIAL MESENCHYMAL TRANSITION DN | 154 | 101 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN UP | 181 | 112 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
HUPER BREAST BASAL VS LUMINAL UP | 54 | 29 | All SZGR 2.0 genes in this pathway |
HOFMANN MYELODYSPLASTIC SYNDROM HIGH RISK DN | 20 | 13 | All SZGR 2.0 genes in this pathway |
HOFMANN MYELODYSPLASTIC SYNDROM RISK DN | 23 | 12 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 | 317 | 177 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP | 134 | 85 | All SZGR 2.0 genes in this pathway |
AZARE NEOPLASTIC TRANSFORMATION BY STAT3 UP | 121 | 70 | All SZGR 2.0 genes in this pathway |
AZARE STAT3 TARGETS | 24 | 12 | All SZGR 2.0 genes in this pathway |
RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF | 222 | 159 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 2211 | 2217 | m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-130/301 | 422 | 428 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-19 | 1656 | 1662 | 1A | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-25/32/92/363/367 | 2734 | 2740 | 1A | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-363 | 1686 | 1692 | 1A | hsa-miR-363 | AUUGCACGGUAUCCAUCUGUAA |
miR-377 | 1754 | 1761 | 1A,m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
miR-493-5p | 2561 | 2567 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
miR-93.hd/291-3p/294/295/302/372/373/520 | 424 | 430 | 1A | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.