Gene Page:SNX3

Summary?
GeneID 8724
Symbol SNX3
Synonyms Grd19|MCOPS8|SDP3
Description sorting nexin 3
Reference MIM:605930|HGNC:HGNC:11174|Ensembl:ENSG00000112335|HPRD:09333|Vega:OTTHUMG00000015323
Gene type protein-coding
Map location 6q21
Pascal p-value 0.279
Fetal beta -1.003
DMG 1 (# studies)
Support G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:vanEijk_2014 Genome-wide DNA methylation analysis This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). 1
Expression Meta-analysis of gene expression Pvalue: 1.513
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0044

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg08417687 6 108582627 SNX3 7.321E-4 -5.052 DMG:vanEijk_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
GLUD1 0.90 0.88
S1PR1 0.88 0.85
GPC5 0.87 0.84
GLUD2 0.87 0.85
SLC1A3 0.87 0.89
HEPH 0.86 0.90
PPAP2B 0.86 0.88
HTRA1 0.86 0.87
ACSS3 0.85 0.90
FAM167A 0.85 0.85
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
DPF1 -0.53 -0.52
MED19 -0.52 -0.56
MARCH4 -0.52 -0.50
MPP3 -0.51 -0.51
ACTL6B -0.51 -0.53
KIAA1543 -0.51 -0.48
AC011491.1 -0.51 -0.56
PAK7 -0.50 -0.47
CABYR -0.50 -0.50
ATXN7L1 -0.50 -0.47

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding IEA -
GO:0035091 phosphoinositide binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007154 cell communication IEA -
GO:0006897 endocytosis TAS 9819414
GO:0015031 protein transport IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005737 cytoplasm IDA 11279102

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN 634 384 All SZGR 2.0 genes in this pathway
PUIFFE INVASION INHIBITED BY ASCITES UP 82 51 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR UP 557 331 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
YANG BREAST CANCER ESR1 LASER DN 50 38 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS 775 494 All SZGR 2.0 genes in this pathway
HASLINGER B CLL WITH 6Q21 DELETION 20 15 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC UP 123 75 All SZGR 2.0 genes in this pathway
DE YY1 TARGETS DN 92 64 All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING 510 309 All SZGR 2.0 genes in this pathway
TOOKER GEMCITABINE RESISTANCE DN 122 84 All SZGR 2.0 genes in this pathway
GOLDRATH ANTIGEN RESPONSE 346 192 All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN 238 145 All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC 1103 714 All SZGR 2.0 genes in this pathway
HOLLEMAN PREDNISOLONE RESISTANCE B ALL UP 22 16 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-142-5p 532 538 1A hsa-miR-142-5p CAUAAAGUAGAAAGCACUAC
miR-539 364 370 m8 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
miR-544 470 477 1A,m8 hsa-miR-544 AUUCUGCAUUUUUAGCAAGU