Gene Page:RGS9

Summary?
GeneID 8787
Symbol RGS9
Synonyms PERRS|RGS9L
Description regulator of G-protein signaling 9
Reference MIM: 604067|HGNC:HGNC:10004|Ensembl:ENSG00000108370|HPRD:04962|Vega:OTTHUMG00000179349
Gene type protein-coding
Map location 17q24.1
Pascal p-value 0.458
Fetal beta -0.273

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search 与精神分裂症Co-occurance关键字s: schizophrenia,schizophrenic,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
LMTK2 0.91 0.91
AP000751.3 0.88 0.88
BSN 0.88 0.89
C17orf51 0.87 0.88
KALRN 0.87 0.88
TLN2 0.87 0.87
SPRED2 0.87 0.89
FMN2 0.87 0.88
MEF2D 0.86 0.88
ZC3H12B 0.86 0.86
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
DBI -0.52 -0.59
C1orf54 -0.50 -0.62
RHOC -0.50 -0.57
GNG11 -0.49 -0.56
AF347015.21 -0.48 -0.51
AL139819.3 -0.46 -0.52
SYCP3 -0.45 -0.57
C1orf61 -0.45 -0.52
VAMP5 -0.44 -0.47
RPS27L -0.44 -0.47

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004871 signal transducer activity IEA -
GO:0005096 GTPase activator activity TAS 9765512
GO:0005515 protein binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0009968 negative regulation of signal transduction IEA -
GO:0007242 intracellular signaling cascade IEA -
GO:0008277 regulation of G-protein coupled receptor protein signaling pathway TAS 9765512
GO:0007601 visual perception IEA -
GO:0050896 response to stimulus IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005834 heterotrimeric G-protein complex IEA -
GO:0016020 membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID CONE PATHWAY 23 8 All SZGR 2.0 genes in this pathway
PID RHODOPSIN PATHWAY 24 10 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR 920 449 All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING 805 368 All SZGR 2.0 genes in this pathway
REACTOME G ALPHA I SIGNALLING EVENTS 195 114 All SZGR 2.0 genes in this pathway
ZHONG RESPONSE TO AZACITIDINE AND TSA UP 183 119 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536 332 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON 335 181 All SZGR 2.0 genes in this pathway
OKUMURA INFLAMMATORY RESPONSE LPS 183 115 All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION 405 264 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP 390 242 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR 544 307 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM A 182 108 All SZGR 2.0 genes in this pathway
GHANDHI DIRECT IRRADIATION UP 110 68 All SZGR 2.0 genes in this pathway
GHANDHI BYSTANDER IRRADIATION UP 86 54 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124.1 255 262 1A,m8 hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA
miR-124/506 255 261 1A hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC