Gene Page:CDK5R1

Summary?
GeneID 8851
Symbol CDK5R1
Synonyms CDK5P35|CDK5R|NCK5A|p23|p25|p35|p35nck5a
Description cyclin-dependent kinase 5, regulatory subunit 1 (p35)
Reference MIM:603460|HGNC:HGNC:1775|Ensembl:ENSG00000176749|HPRD:04586|Vega:OTTHUMG00000132814
Gene type protein-coding
Map location 17q11.2
Pascal p-value 9.503E-5
Sherlock p-value 0.92
Fetal beta 0.709
DMG 1 (# studies)
eGene Myers' cis & trans
Support G2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet
Darnell FMRP targets
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Nishioka_2013 Genome-wide DNA methylation analysis The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 14

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg07658718 17 30814514 CDK5R1 -0.021 0.84 DMG:Nishioka_2013

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs7132043 chr12 80968399 CDK5R1 8851 0.19 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
LTV1 0.84 0.83
MED4 0.84 0.81
PARP2 0.84 0.80
RAD17 0.83 0.81
EXOC1 0.83 0.81
USP16 0.82 0.81
UBA5 0.82 0.80
GTF2H1 0.82 0.79
HERC4 0.82 0.79
DNAJC10 0.82 0.80
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MT-CO2 -0.75 -0.63
AF347015.2 -0.73 -0.62
AF347015.21 -0.73 -0.59
AF347015.31 -0.73 -0.63
AF347015.8 -0.73 -0.62
MT-CYB -0.72 -0.60
AF347015.15 -0.70 -0.61
AF347015.33 -0.69 -0.57
AF347015.27 -0.68 -0.58
HIGD1B -0.68 -0.61

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005509 calcium ion binding ISS -
GO:0005515 protein binding 新闻学会 10721722|12223541
GO:0005515 protein binding ISS -
GO:0004672 protein kinase activity TAS 7592934
GO:0016534 cyclin-dependent protein kinase 5 activator activity IEA -
GO:0045296 cadherin binding ISS -
GO:0043539 protein serine/threonine kinase activator activity ISS -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007420 大脑发育 ISS Brain (GO term level: 7) -
GO:0007420 大脑发育 NAS Brain (GO term level: 7) 10915792
GO:0007413 axonal fasciculation ISS neuron, axon (GO term level: 13) -
GO:0007411 axon guidance ISS axon (GO term level: 13) -
GO:0001764 neuron migration ISS neuron (GO term level: 8) -
GO:0031175 neurite development ISS neuron, axon, neurite, dendrite (GO term level: 10) -
GO:0007158 neuron adhesion ISS neuron (GO term level: 5) -
GO:0045664 regulation of neuron differentiation NAS neuron, neurogenesis (GO term level: 9) 10721722
GO:0043525 positive regulation of neuron apoptosis ISS neuron (GO term level: 9) -
GO:0035235 ionotropic glutamate receptor signaling pathway ISS glutamate (GO term level: 8) -
GO:0000079 regulation of cyclin-dependent protein kinase activity TAS 7592934
GO:0007213 acetylcholine receptor signaling, muscarinic pathway ISS -
GO:0008283 cell proliferation TAS 8090221
GO:0009790 embryonic development ISS -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0043025 cell soma ISS axon, dendrite (GO term level: 4) -
去:0031594 neuromuscular junction ISS neuron, axon, Synap, Neurotransmitter (GO term level: 3) -
GO:0043197 dendritic spine ISS Synap, dendrite (GO term level: 7) -
GO:0030426 growth cone ISS axon, dendrite (GO term level: 5) -
GO:0030424 axon ISS neuron, axon, Neurotransmitter (GO term level: 6) -
GO:0005634 nucleus ISS -
GO:0005737 cytoplasm ISS -
GO:0005886 plasma membrane IEA -
GO:0016533 cyclin-dependent protein kinase 5 activator complex IEA -
GO:0043292 contractile fiber ISS -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ACTN1 FLJ40884 actinin, alpha 1 Affinity Capture-Western
Reconstituted Complex
Two-hybrid		 BioGRID 12223541
AMPH AMPH1 amphiphysin Amphiphysin 1 interacts with p35. This interaction was modeled on a demonstrated interaction between human amphiphysin 1 and rat p35. BIND 11113134
AMPH AMPH1 amphiphysin - HPRD,BioGRID 11113134
CAMK2A CAMKA | KIAA0968 calcium/calmodulin-dependent protein kinase II alpha - HPRD,BioGRID 12223541
CDK5 PSSALRE cyclin-dependent kinase 5 p35 interacts with Cdk5. This interaction was modeled on a demonstrated interaction between bovine p35 and human Cdk5. BIND 9038181
CDK5 PSSALRE cyclin-dependent kinase 5 - HPRD,BioGRID 11583627
CDK5 PSSALRE cyclin-dependent kinase 5 Cdk5 interacts with p35. BIND 8090221
CDK5R1 CDK5P35 | CDK5R | MGC33831 | NCK5A | p23 | p25 | p35 | p35nck5a cyclin-dependent kinase 5, regulatory subunit 1 (p35) - HPRD 11389014
CDK5RAP1 C20orf34 | C42 | CDK5RAP1.3 | CDK5RAP1.4 | CGI-05 | HSPC167 CDK5 regulatory subunit associated protein 1 - HPRD,BioGRID 10721722|10915792
|11882646
CDK5RAP1 C20orf34 | C42 | CDK5RAP1.3 | CDK5RAP1.4 | CGI-05 | HSPC167 CDK5 regulatory subunit associated protein 1 - HPRD 11882646
CDK5RAP2 C48 | Cep215 | DKFZp686B1070 | DKFZp686D1070 | KIAA1633 | MCPH3 CDK5 regulatory subunit associated protein 2 in vitro
in vivo
Reconstituted Complex		 BioGRID 10915792|11882646
CDK5RAP2 C48 | Cep215 | DKFZp686B1070 | DKFZp686D1070 | KIAA1633 | MCPH3 CDK5 regulatory subunit associated protein 2 - HPRD 10721722
CDK5RAP3 C53 | HSF-27 | IC53 | LZAP | MST016 | OK/SW-cl.114 CDK5 regulatory subunit associated protein 3 - HPRD 10721722|10915792
CDK5RAP3 C53 | HSF-27 | IC53 | LZAP | MST016 | OK/SW-cl.114 CDK5 regulatory subunit associated protein 3 - HPRD,BioGRID 11882646
CDK9 C-2k | CDC2L4 | CTK1 | PITALRE | TAK cyclin-dependent kinase 9 - HPRD 12037672
CTNNB1 CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 catenin (cadherin-associated protein), beta 1, 88kDa Affinity Capture-Western
Reconstituted Complex		 BioGRID 11168528
LMTK2 AATYK2 | BREK | KIAA1079 | KPI-2 | KPI2 | LMR2 | cprk lemur tyrosine kinase 2 - HPRD 12832520
NES FLJ21841 | Nbla00170 巢蛋白 - HPRD 12832492
PAK1 MGC130000 | MGC130001 | PAKalpha p21 protein (Cdc42/Rac)-activated kinase 1 - HPRD 11604394
PCTK1 FLJ16665 | PCTAIRE | PCTAIRE1 | PCTGAIRE PCTAIRE protein kinase 1 Affinity Capture-Western
Reconstituted Complex
Two-hybrid		 BioGRID 12084709
SET 2PP2A | I2PP2A | IGAAD | IPP2A2 | PHAPII | TAF-I | TAF-IBETA SET nuclear oncogene - HPRD,BioGRID 11741927
TSC22D4 THG-1 | THG1 TSC22 domain family, member 4 Two-hybrid BioGRID 16189514
TTBK1 BDTK | KIAA1855 | RP3-330M21.4 tau tubulin kinase 1 - HPRD 7556643


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ALZHEIMERS DISEASE 169 110 All SZGR 2.0 genes in this pathway
BIOCARTA P35ALZHEIMERS PATHWAY 11 9 All SZGR 2.0 genes in this pathway
BIOCARTA CDK5 PATHWAY 11 11 All SZGR 2.0 genes in this pathway
BIOCARTA RAC1 PATHWAY 23 16 All SZGR 2.0 genes in this pathway
BIOCARTA CK1 PATHWAY 17 17 All SZGR 2.0 genes in this pathway
PID REELIN PATHWAY 29 29 All SZGR 2.0 genes in this pathway
PID REG GR PATHWAY 82 60 All SZGR 2.0 genes in this pathway
PID LIS1 PATHWAY 28 22 All SZGR 2.0 genes in this pathway
PID MAPK TRK PATHWAY 34 31 All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY 396 292 All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE 251 188 All SZGR 2.0 genes in this pathway
REACTOME CRMPS IN SEMA3A SIGNALING 14 14 All SZGR 2.0 genes in this pathway
REACTOME SEMAPHORIN INTERACTIONS 68 53 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP 783 507 All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP 233 161 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP 276 165 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 2 UP 139 83 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP 341 197 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN 459 276 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR DN 209 122 All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN 226 132 All SZGR 2.0 genes in this pathway
GRAESSMANN B细胞凋亡Y SERUM DEPRIVATION UP 552 347 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP 211 136 All SZGR 2.0 genes in this pathway
GRAESSMANN B细胞凋亡Y DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
NUNODA RESPONSE TO DASATINIB IMATINIB UP 29 20 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN 164 111 All SZGR 2.0 genes in this pathway
KIM MYCL1 AMPLIFICATION TARGETS UP 13 11 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP 195 138 All SZGR 2.0 genes in this pathway
STARK HYPPOCAMPUS 22Q11 DELETION UP 53 40 All SZGR 2.0 genes in this pathway
STARK BRAIN 22Q11 DELETION 13 10 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN 357 212 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN 464 276 All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN 153 120 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
MARTINEZ RESPONSE TO TRABECTEDIN DN 271 175 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 473 224 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS DN 292 189 All SZGR 2.0 genes in this pathway
OUILLETTE CLL 13Q14 DELETION DN 60 38 All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING UP 115 80 All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1 91 75 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
HOFFMANN IMMATURE TO MATURE B LYMPHOCYTE UP 43 34 All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER POOR SURVIVAL A6 456 285 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177 132 All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN 414 237 All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP 387 225 All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP 211 131 All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 1HR UP 34 26 All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR DN 114 69 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-101 2673 2679 m8 hsa-miR-101 UACAGUACUGUGAUAACUGAAG
miR-103/107 2094 2100 m8 hsa-miR-103brain AGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brain AGCAGCAUUGUACAGGGCUAUCA
miR-148/152 2695 2702 1A,m8 hsa-miR-148a UCAGUGCACUACAGAACUUUGU
hsa-miR-152brain UCAGUGCAUGACAGAACUUGGG
hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
miR-15/16/195/424/497 2095 2102 1A,m8 hsa-miR-15abrain UAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brain UAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrain UAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZ UAGCAGCACAGAAAUAUUGGC
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497 CAGCAGCACACUGUGGUUUGU
miR-183 2404 2410 m8 hsa-miR-183 UAUGGCACUGGUAGAAUUCACUG
miR-208 2211 2217 1A hsa-miR-208 AUAAGACGAGCAAAAAGCUUGU
miR-23 1315 1322 1A,m8 hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-27 1481 1487 1A hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC
miR-323 1315 1321 1A hsa-miR-323brain GCACAUUACACGGUCGACCUCU
miR-362 24 30 m8 hsa-miR-362 AAUCCUUGGAACCUAGGUGUGAGU
miR-376 2100 2106 1A hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
miR-433-3p 2615 2621 1A hsa-miR-433brain AUCAUGAUGGGCUCCUCGGUGU
miR-499 2211 2217 1A hsa-miR-499 UUAAGACUUGCAGUGAUGUUUAA
miR-503 2096 2102 1A hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG