Gene Page:LDB1

Summary?
GeneID 8861
Symbol LDB1
Synonyms CLIM2|NLI
Description LIM domain binding 1
Reference MIM:603451|HGNC:HGNC:6532|Ensembl:ENSG00000198728|HPRD:09144|Vega:OTTHUMG00000018950
Gene type protein-coding
Map location 10q24-q25
Pascal p-value 8.076E-4
Fetal beta -0.441
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg17915961 10 103881480 LDB1 5.404E-4 0.467 0.048 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SMPD4 0.95 0.95
TSC2 0.95 0.95
CIZ1 0.94 0.93
PPRC1 0.94 0.94
EDC4 0.94 0.95
PPIL2 0.93 0.93
DHX34 0.93 0.92
KIAA0892 0.93 0.93
MAST2 0.93 0.92
AC145098.2 0.93 0.93
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.31 -0.76 -0.86
AF347015.27 -0.74 -0.84
MT-CO2 -0.74 -0.85
AF347015.8 -0.72 -0.84
MT-CYB -0.72 -0.82
AF347015.33 -0.72 -0.80
AF347015.21 -0.70 -0.91
AF347015.15 -0.69 -0.81
HIGD1B -0.68 -0.79
C5orf53 -0.68 -0.70

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003714 transcription corepressor activity TAS 9391090
GO:0030274 LIM domain binding 新闻学会 12792813
GO:0030274 LIM domain binding ISS -
GO:0042803 protein homodimerization activity ISS -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0030182 neuron differentiation ISS neuron (GO term level: 8) -
GO:0007275 multicellular organismal development NAS 12792813
GO:0045647 negative regulation of erythrocyte differentiation ISS -
GO:0045892 negative regulation of transcription, DNA-dependent IDA 10767331
GO:0045892 negative regulation of transcription, DNA-dependent ISS -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus ISS -
GO:0043234 protein complex ISS -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BIOCARTA PITX2 PATHWAY 15 15 All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL UP 276 187 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP 633 376 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP 479 299 All SZGR 2.0 genes in this pathway
YAGI AML FAB MARKERS 191 131 All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX UP 83 66 All SZGR 2.0 genes in this pathway
MEDINA SMARCA4 TARGETS 44 29 All SZGR 2.0 genes in this pathway
KIM GASTRIC CANCER CHEMOSENSITIVITY 103 64 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS 217 138 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS REQUIRE MYC 210 123 All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC 58 43 All SZGR 2.0 genes in this pathway
由喀斯特IWANAGA致癌PTEN 181 112 All SZGR 2.0 genes in this pathway
SAGIV CD24 TARGETS UP 23 15 All SZGR 2.0 genes in this pathway
SAGIV CD24 TARGETS DN 46 26 All SZGR 2.0 genes in this pathway
CHANG CORE SERUM RESPONSE DN 209 137 All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED 351 238 All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS UP 221 120 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B 517 302 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 227 149 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-125/351 121 127 1A hsa-miR-125bbrain UCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrain UCCCUGAGACCCUUUAACCUGUG
miR-365 282 288 m8 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
miR-96 151 157 m8 hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC