Gene Page:PER3

Summary?
GeneID 8863
Symbol PER3
Synonyms GIG13
Description period circadian clock 3
Reference MIM:603427|HGNC:HGNC:8847|Ensembl:ENSG00000049246|HPRD:09138|Vega:OTTHUMG00000001216
Gene type protein-coding
Map location 1p36.23
Pascal p-value 0.238
Sherlock p-value 0.296
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed的基因s co-occurring with SCZ keywords. A total of 3027 genes were included.
Association A combined odds ratio method (Sun et al. 2008), association studies 1 Link to SZGene
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16829545 chr2 151977407 PER3 8863 8.034E-5 trans
rs4265582 chr11 18797649 PER3 8863 0.17 trans
rs16955618 chr15 29937543 PER3 8863 6.618E-4 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
PPEF1 0.57 0.54
THOC7 0.48 0.51
TCEAL1 0.48 0.52
FABP3 0.47 0.56
TM6SF1 0.46 0.52
GPR160 0.45 0.49
MMD 0.45 0.47
UPP2 0.45 0.45
C2orf80 0.44 0.46
ACTR10 0.43 0.45
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
PLXNB1 -0.32 -0.39
CASKIN2 -0.31 -0.39
SORBS3 -0.31 -0.37
PXN -0.30 -0.37
ABTB2 -0.29 -0.36
GPR56 -0.29 -0.37
KIAA0195 -0.29 -0.31
SH3BP4 -0.29 -0.34
PLCB3 -0.29 -0.32
LLGL1 -0.28 -0.30

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004871 signal transducer activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0006350 transcription IEA -
GO:0007165 signal transduction IEA -
GO:0007623 circadian rhythm IEA -
GO:0048511 rhythmic process IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG CIRCADIAN RHYTHM MAMMAL 13 13 All SZGR 2.0 genes in this pathway
PYEON HPV POSITIVE TUMORS UP 98 47 All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER DN 481 290 All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE DN 244 147 All SZGR 2.0 genes in this pathway
HORIUCHI WTAP TARGETS UP 306 188 All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP 456 228 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN 459 276 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN 805 505 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN 508 354 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2A DN 141 84 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK DN 196 131 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK DN 79 54 All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 77 51 All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION CCNE1 40 26 All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN 800 473 All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS LUMINAL 326 213 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM6 46 32 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
CHESLER BRAIN QTL CIS 75 51 All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS DN 234 137 All SZGR 2.0 genes in this pathway
LINDVALL IMMORTALIZED BY TERT DN 80 56 All SZGR 2.0 genes in this pathway
HENDRICKS SMARCA4 TARGETS DN 53 34 All SZGR 2.0 genes in this pathway
JIANG HYPOXIA CANCER 83 52 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP 425 298 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR UP 293 203 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN 457 302 All SZGR 2.0 genes in this pathway
PYEON CANCER HEAD AND NECK VS CERVICAL UP 193 95 All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN 306 191 All SZGR 2.0 genes in this pathway
OHGUCHI LIVER HNF4A TARGETS UP 44 30 All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS 289 187 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP 504 321 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN 918 550 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745 475 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080 713 All SZGR 2.0 genes in this pathway
SERVITJA LIVER HNF1A TARGETS UP 135 96 All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR DN 244 157 All SZGR 2.0 genes in this pathway
ZWANG DOWN BY 2ND EGF PULSE 293 119 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-194 361 368 1A,m8 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
miR-29 1925 1931 m8 hsa-miR-29aSZ UAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZ UAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZ UAGCACCAUUUGAAAUCGGU