Gene Page:FUBP1
Summary?
| GeneID | 8880 |
| Symbol | FUBP1 |
| Synonyms | FBP|FUBP|hDH V |
| Description | far upstream element binding protein 1 |
| Reference | MIM:603444|HGNC:HGNC:4004|Ensembl:ENSG00000162613|HPRD:10349|Vega:OTTHUMG00000040799 |
| Gene type | protein-coding |
| Map location | 1p31.1 |
| Pascal p-value | 0.047 |
| Sherlock p-value | 0.605 |
Gene in Data Sources
| 基因集名称 | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02692 |
Section I. Genetics and epigenetics annotation
DNM table
DNM table| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| FUBP1 | chr1 | 78430612 | C | T | NM_003902 | . | silent | Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC:分皮质区域;SM:感觉运动区域s; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| CCK | 0.81 | 0.86 |
| VIP | 0.80 | 0.89 |
| RHEBL1 | 0.79 | 0.75 |
| CA11 | 0.78 | 0.77 |
| ITPKA | 0.78 | 0.80 |
| CASQ1 | 0.77 | 0.73 |
| ENSA | 0.77 | 0.68 |
| ACOT4 | 0.77 | 0.78 |
| ABCC12 | 0.76 | 0.87 |
| RUNDC3A | 0.76 | 0.70 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FADS2 | -0.53 | -0.59 |
| PDE9A | -0.52 | -0.65 |
| KIAA1949 | -0.52 | -0.56 |
| TUBB2B | -0.51 | -0.60 |
| SH3BP2 | -0.51 | -0.64 |
| PKN1 | -0.51 | -0.61 |
| LIMK2 | -0.51 | -0.67 |
| SEMA4B | -0.50 | -0.57 |
| FBLN1 | -0.50 | -0.62 |
| ZNF792 | -0.50 | -0.57 |
Section III. Gene Ontology annotation
| Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| 去:0003697 | single-stranded DNA binding | TAS | 8125259 | |
| GO:0003700 | transcription factor activity | TAS | 8125259 | |
| GO:0003723 | RNA binding | IEA | - | |
| GO:0005515 | protein binding | 新闻学会 | 17353931 | |
| Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0006350 | transcription | IEA | - | |
| GO:0006366 | transcription from RNA polymerase II promoter | TAS | 8125259 | |
| Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005730 | nucleolus | IDA | 18029348 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| CCNH | CAK | p34 | p37 | cyclin H | - | HPRD,BioGRID | 11239393 |
| CHD3 | Mi-2a | Mi2-ALPHA | ZFH | chromodomain helicase DNA binding protein 3 | Two-hybrid | BioGRID | 16169070 |
| CRMP1 | DPYSL1 | DRP-1 | DRP1 | collapsin response mediator protein 1 | Two-hybrid | BioGRID | 16169070 |
| CUGBP1 | BRUNOL2 | CUG-BP | CUGBP | NAB50 | hNab50 | CUG triplet repeat, RNA binding protein 1 | Two-hybrid | BioGRID | 16169070 |
| GTF2H1 | BTF2 | TFB1 | TFIIH | general transcription factor IIH, polypeptide 1, 62kDa | - | HPRD,BioGRID | 11239393 |
| IMMT | DKFZp779P1653 | HMP | MGC111146 | P87 | P87/89 | P89 | PIG4 | PIG52 | inner membrane protein, mitochondrial (mitofilin) | - | HPRD | 11239393 |
| JTV1 | AIMP2 | P38 | PRO0992 | JTV1 gene | - | HPRD | 12819782 |
| KHSRP | FBP2 | FUBP2 | KSRP | MGC99676 | KH-type splicing regulatory protein | - | HPRD | 11003644 |
| MAPK14 | CSBP1 | CSBP2 | CSPB1 | EXIP | Mxi2 | PRKM14 | PRKM15 | RK | SAPK2A | p38 | p38ALPHA | mitogen-activated protein kinase 14 | Affinity Capture-Western Reconstituted Complex Two-hybrid |
BioGRID | 12819782 |
| MYC | bHLHe39 | c-Myc | v-myc myelocytomatosis viral oncogene homolog (avian) | FBP interacts with FUSE. | BIND | 15502847 |
| PUF60 | FIR | FLJ31379 | RoBPI | SIAHBP1 | poly-U binding splicing factor 60KDa | - | HPRD | 10882074 |
| SMN1 | BCD541 | SMA | SMA1 | SMA2 | SMA3 | SMA4 | SMA@ | SMN | SMNT | T-BCD541 | survival of motor neuron 1, telomeric | - | HPRD,BioGRID | 10734235 |
| SNCG | BCSG1 | SR | synuclein, gamma (breast cancer-specific protein 1) | Affinity Capture-MS | BioGRID | 17353931 |
| TLE1 | ESG | ESG1 | GRG1 | transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) | Two-hybrid | BioGRID | 16169070 |
| VIM | FLJ36605 | vimentin | Two-hybrid | BioGRID | 16169070 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PYEON HPV POSITIVE TUMORS UP | 98 | 47 | All SZGR 2.0 genes in this pathway |
| LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
| GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
| DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
| WANG LMO4 TARGETS UP | 372 | 227 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN | 180 | 101 | All SZGR 2.0 genes in this pathway |
| UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| HAHTOLA MYCOSIS FUNGOIDES CD4 DN | 116 | 71 | All SZGR 2.0 genes in this pathway |
| MARKEY RB1 ACUTE LOF DN | 228 | 137 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 5 6WK DN | 137 | 97 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| WANG HCP PROSTATE CANCER | 111 | 69 | All SZGR 2.0 genes in this pathway |
| PUJANA XPRSS INT NETWORK | 168 | 103 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
| GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
| GOLDRATH HOMEOSTATIC PROLIFERATION | 171 | 102 | All SZGR 2.0 genes in this pathway |
| SHEPARD CRUSH AND BURN MUTANT DN | 185 | 111 | All SZGR 2.0 genes in this pathway |
| DER IFN BETA RESPONSE UP | 102 | 67 | All SZGR 2.0 genes in this pathway |
| PENG GLUCOSE DEPRIVATION DN | 169 | 112 | All SZGR 2.0 genes in this pathway |
| TAKAO RESPONSE TO UVB RADIATION UP | 86 | 55 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
| MA PITUITARY FETAL VS ADULT UP | 29 | 21 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 10HR UP | 101 | 69 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
| MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
| NICK RESPONSE TO PROC TREATMENT DN | 27 | 18 | All SZGR 2.0 genes in this pathway |
| LEE DIFFERENTIATING T LYMPHOCYTE | 200 | 115 | All SZGR 2.0 genes in this pathway |
| ASGHARZADEH NEUROBLASTOMA POOR SURVIVAL DN | 46 | 30 | All SZGR 2.0 genes in this pathway |
| DORN ADENOVIRUS INFECTION 12HR UP | 29 | 18 | All SZGR 2.0 genes in this pathway |
| DORN ADENOVIRUS INFECTION 24HR DN | 43 | 32 | All SZGR 2.0 genes in this pathway |
| DORN ADENOVIRUS INFECTION 32HR DN | 39 | 28 | All SZGR 2.0 genes in this pathway |
| DORN ADENOVIRUS INFECTION 48HR DN | 40 | 29 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 2 | 86 | 50 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
| DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
| DELACROIX RAR TARGETS DN | 24 | 16 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP | 289 | 184 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-132/212 | 755 | 761 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
| hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
| miR-15/16/195/424/497 | 700 | 707 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-155 | 648 | 654 | 1A | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-199 | 480 | 486 | m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
| miR-21 | 447 | 453 | m8 | hsa-miR-21brain | UAGCUUAUCAGACUGAUGUUGA |
| hsa-miR-590 | GAGCUUAUUCAUAAAAGUGCAG | ||||
| mir - 218 | 557 | 563 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-503 | 701 | 707 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.