Gene Page:EIF2B2

Summary?
GeneID 8892
Symbol EIF2B2
Synonyms EIF-2Bbeta|EIF2B
Description eukaryotic translation initiation factor 2B subunit beta
Reference MIM:606454|HGNC:HGNC:3258|HPRD:05923|
Gene type protein-coding
Map location 14q24.3
Pascal p-value 0.504
Sherlock p-value 0.965
Fetal beta -0.176
DMG 1 (# studies)
eGene Hypothalamus
元

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Montano_2016 Genome-wide DNA methylation analysis This dataset includes 172 replicated associations between CpGs with schizophrenia. 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 3

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg15943584 14 75472643 EIF2B2 3.63E-4 -0.006 0.193 DMG:Montano_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SH3TC1 0.62 0.35
IGFBP1 0.59 0.27
C10orf10 0.57 0.21
EDN1 0.56 0.13
IL4R 0.56 0.39
HRCT1 0.54 -0.06
TBX1 0.51 0.26
CLDN5 0.49 0.20
TNFRSF12A 0.48 0.25
CEBPD 0.47 0.16
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
HSPA5 -0.35 -0.26
HDHD2 -0.35 -0.21
SBDS -0.35 -0.25
ERGIC2 -0.34 -0.23
PDHB -0.34 -0.22
C19orf2 -0.34 -0.18
PPP2CB -0.34 -0.20
IARS2 -0.34 -0.19
AC023598.3 -0.33 -0.31
PPP2R5A -0.33 -0.29

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005085 guanyl-nucleotide交换因素活动 IDA 11323413
GO:0005085 guanyl-nucleotide交换因素活动 IMP 15054402
GO:0003743 translation initiation factor activity IDA 16289705
GO:0005515 protein binding IPI 15060152
GO:0005524 ATP binding IDA 11323413
GO:0005525 GTP binding IDA 11323413
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007417 central nervous system development IMP Brain (GO term level: 6) 15776425
GO:0014003 oligodendrocyte development IMP axon, oligodendrocyte, Glial (GO term level: 10) 15217090
GO:0042552 myelination IMP neuron, axon, Brain, oligodendrocyte (GO term level: 13) 14566705
GO:0001541 ovarian follicle development IMP 15507143
GO:0006446 regulation of translational initiation TAS 15060152
GO:0009408 response to heat ISS -
GO:0009408 response to heat TAS 12499492
GO:0009749 response to glucose stimulus ISS -
GO:0043434 response to peptide hormone stimulus ISS -
GO:0044237 cellular metabolic process IEA -
GO:0051716 cellular response to stimulus IDA 8626696
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005851 eukaryotic translation initiation factor 2B complex IDA 11323413|15060152
GO:0005634 nucleus IDA 18029348
GO:0005730 nucleolus IDA 18029348
GO:0005737 cytoplasm IDA 11323413

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BIOCARTA VEGF PATHWAY 29 18 All SZGR 2.0 genes in this pathway
REACTOME TRANSLATION 222 75 All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF PROTEINS 518 242 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP 293 179 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
是RENJENO TRANSFORMED BY RHOA UP 536 340 All SZGR 2.0 genes in this pathway
HEIDENBLAD AMPLICON 12P11 12 UP 33 17 All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN 245 154 All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN 162 102 All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS DN 141 92 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP 973 570 All SZGR 2.0 genes in this pathway
GU PDEF TARGETS DN 39 20 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-378 267 274 1A,m8 hsa-miR-378 CUCCUGACUCCAGGUCCUGUGU