Gene Page:PHOX2B

Summary?
GeneID 8929
Symbol PHOX2B
Synonyms NBLST2|NBPhox|PMX2B
Description paired like homeobox 2b
Reference MIM:603851|HGNC:HGNC:9143|Ensembl:ENSG00000109132|HPRD:09157|Vega:OTTHUMG00000099379
Gene type protein-coding
Map location 4p12
Pascal p-value 0.376
Fetal beta 0.195

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统的搜索PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association A combined odds ratio method (Sun et al. 2008), association studies 1 Link to SZGene
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
FAM96B 0.92 0.91
EXOSC4 0.91 0.91
PSMB3 0.91 0.89
EXOSC5 0.91 0.90
C12orf10 0.90 0.89
NOSIP 0.90 0.88
SF3B5 0.90 0.88
PSMB4 0.89 0.88
ANAPC11 0.89 0.85
CUEDC2 0.89 0.88
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.26 -0.54 -0.57
AF347015.18 -0.50 -0.56
AF347015.8 -0.50 -0.50
AF347015.15 -0.50 -0.52
MT-ATP8 -0.49 -0.54
AF347015.2 -0.49 -0.51
MT-CYB -0.48 -0.51
AF347015.27 -0.48 -0.52
AF347015.33 -0.48 -0.51
ANKRD18B -0.45 -0.56

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003700 transcription factor activity TAS 10395798
GO:0003712 transcription cofactor activity TAS 10395798
GO:0043565 sequence-specific DNA binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development TAS neurite (GO term level: 5) 10395798
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0048468 cell development IEA -
GO:0007275 multicellular organismal development IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
LEE NEURAL CREST STEM CELL UP 146 99 All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN DN 172 112 All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN 203 134 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP 398 262 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL RUNX1 9 6 All SZGR 2.0 genes in this pathway
XU GH1 EXOGENOUS TARGETS DN 120 69 All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP 323 240 All SZGR 2.0 genes in this pathway
MIKKELSEN PARTIALLY REPROGRAMMED TO PLURIPOTENCY 10 6 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS WITH HCP H3K27ME3 102 76 All SZGR 2.0 genes in this pathway
MIKKELSEN ES HCP WITH H3K27ME3 41 30 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN 448 282 All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS UP 163 111 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-125/351 323 329 m8 hsa-miR-125bbrain UCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrain UCCCUGAGACCCUUUAACCUGUG
miR-138 1002 1008 m8 hsa-miR-138brain AGCUGGUGUUGUGAAUC
miR-146 1444 1450 1A hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU
hsa-miR-146bbrain UGAGAACUGAAUUCCAUAGGCU
miR-181 1285 1291 m8 hsa-miR-181abrain AACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZ AACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrain AACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrain AACAUUCAUUGUUGUCGGUGGGUU
miR-320 1005 1011 m8 hsa-miR-320 AAAAGCUGGGUUGAGAGGGCGAA
miR-494 1584 1591 1A,m8 hsa-miR-494brain UGAAACAUACACGGGAAACCUCUU
miR-495 1505 1511 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
miR-500 1514 1520 m8 hsa-miR-500 AUGCACCUGGGCAAGGAUUCUG
miR-543 1286 1292 m8 hsa-miR-543 AAACAUUCGCGGUGCACUUCU
miR-7 997 1003 1A hsa-miR-7SZ UGGAAGACUAGUGAUUUUGUUG