Gene Page:WNT3A

Summary?
GeneID 89780
Symbol WNT3A
Synonyms -
Description wingless-type MMTV integration site family member 3A
Reference MIM:606359|HGNC:HGNC:15983|Ensembl:ENSG00000154342|HPRD:05897|Vega:OTTHUMG00000037593
Gene type protein-coding
Map location 1q42
Fetal beta -0.068
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
PMID:cooccur High-throughput literature-search 系统搜索我n PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations 支安打与neuro-related关键词:1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg01313514 1 228194916 WNT3A 8.84E-10 -0.019 1.1E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004871 signal transducer activity IEA -
GO:0005515 protein binding IEA -
GO:0005201 extracellular matrix structural constituent NAS -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007409 axonogenesis IEA neuron, axon, neurite (GO term level: 12) -
GO:0001756 somitogenesis IEA -
GO:0001701 in utero embryonic development IEA -
GO:0001947 heart looping IEA -
GO:0007368 determination of left/right symmetry IEA -
GO:0007267 cell-cell signaling NAS -
GO:0007223 Wnt receptor signaling pathway, calcium modulating pathway IEA -
GO:0048103 somatic stem cell division IEA -
GO:0007275 multicellular organismal development IEA -
GO:0048343 paraxial mesodermal cell fate commitment IEA -
GO:0042472 inner ear morphogenesis IEA -
GO:0030879 mammary gland development IEA -
GO:0030097 hemopoiesis IEA -
GO:0045595 regulation of cell differentiation IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0005576 extracellular region NAS -
GO:0005578 proteinaceous extracellular matrix IEA -
GO:0005615 extracellular space IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG WNT SIGNALING PATHWAY 151 112 All SZGR 2.0 genes in this pathway
KEGG HEDGEHOG SIGNALING PATHWAY 56 42 All SZGR 2.0 genes in this pathway
KEGG MELANOGENESIS 102 80 All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER 328 259 All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA 55 44 All SZGR 2.0 genes in this pathway
WNT SIGNALING 89 71 All SZGR 2.0 genes in this pathway
PID BETA CATENIN DEG PATHWAY 18 17 All SZGR 2.0 genes in this pathway
PID WNT SIGNALING PATHWAY 28 23 All SZGR 2.0 genes in this pathway
PID WNT CANONICAL PATHWAY 20 18 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR 920 449 All SZGR 2.0 genes in this pathway
REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS 88 58 All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408 246 All SZGR 2.0 genes in this pathway
HWANG PROSTATE CANCER MARKERS 28 19 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM UP 176 111 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 8 36 28 All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1 91 75 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K27ME3 269 159 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349 234 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341 243 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS 344 197 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-103/107 1770 1776 m8 hsa-miR-103brain AGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brain AGCAGCAUUGUACAGGGCUAUCA
miR-128 1636 1643 1A,m8 hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-15/16/195/424/497 1771 1778 1A,m8 hsa-miR-15abrain UAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brain UAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrain UAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZ UAGCAGCACAGAAAUAUUGGC
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497 CAGCAGCACACUGUGGUUUGU
miR-27 1637 1644 1A,m8 hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC
miR-503 1772 1778 1A hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG