SZGR2 - Beplay体育中心

Summary?

GeneID	9020
Symbol	MAP3K14
Synonyms	FTDCR1B\|HS\|HSNIK\|NIK
Description	mitogen-activated protein kinase kinase kinase 14
Reference	MIM:604655\|HGNC:HGNC:6853\|Ensembl:ENSG00000006062\|HPRD:05230\|Vega:OTTHUMG00000180364
Gene type	protein-coding
Map location	17q21
Pascal p-value	0.653
Sherlock p-value	0.025
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1134

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs5988076	chrX	113894988	MAP3K14	9020	0.14	trans
rs4145870	chrX	114031674	MAP3K14	9020	0.1	trans
rs5945997	chrX	114039444	MAP3K14	9020	0.1	trans
rs5946197		0	MAP3K14	9020	0.05	trans
rs4911874	chrX	114087957	MAP3K14	9020	0.13	trans
rs5946229	chrX	114146933	MAP3K14	9020	0.07	trans
rs6644132	chrX	114153066	MAP3K14	9020	0.03	trans
rs5946239	chrX	114163119	MAP3K14	9020	0.03	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SLC2A6	0.89	0.89
CHAC1	0.86	0.89
SLC27A4	0.86	0.85
SEZ6L2	0.85	0.88
CHPF	0.85	0.87
PPP2R5B	0.84	0.85
LENG4	0.83	0.88
ATP13A2	0.83	0.82
ZDHHC14	0.83	0.85
SLC45A1	0.83	0.84

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
NSBP1	-0.48	-0.51
AF347015.21	-0.45	-0.33
RAB13	-0.45	-0.54
AF347015.18	-0.45	-0.36
AF347015.8	-0.43	-0.32
MT-ATP8	-0.43	-0.33
AP002478.3	-0.43	-0.42
AF347015.2	-0.42	-0.28
ANP32B	-0.41	-0.46
AF347015.31	-0.40	-0.31

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005515	protein binding	新闻学会		9520446\|10094049\|10733566 \|11035039\|12874243 \|16286467\|18022362
GO:0005524	ATP binding	IEA		-
GO:0004672	protein kinase activity	IEA		-
GO:0004674	protein serine/threonine kinase activity	IEA		-
GO:0004709	MAP kinase kinase kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006468	protein amino acid phosphorylation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005737	cytoplasm	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ATP5A1	ATP5A \| ATP5AL2 \| ATPM \| MOM2 \| OMR \| ORM \| hATP1	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	-	HPRD	14743216
CASP10	ALPS2 \| FLICE2 \| MCH4	caspase 10, apoptosis-related cysteine peptidase	Affinity Capture-Western	BioGRID	11002417
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	Affinity Capture-Western	BioGRID	11002417
CASP8	ALPS2B \| CAP4 \| FLICE \| FLJ17672 \| MACH \| MCH5 \| MGC78473	caspase 8, apoptosis-related cysteine peptidase	-	HPRD,BioGRID	11002417
CFLAR	CASH \| CASP8AP1 \| CLARP \| Casper \| FLAME \| FLAME-1 \| FLAME1 \| FLIP \| I-FLICE \| MRIT \| c-FLIP \| c-FLIPL \| c-FLIPR \| c-FLIPS	CASP8 and FADD-like apoptosis regulator	Affinity Capture-Western	BioGRID	11002417
CHUK	IKBKA \| IKK-alpha \| IKK1 \| IKKA \| NFKBIKA \| TCF16	conserved helix-loop-helix ubiquitous kinase	-	HPRD,BioGRID	9244310
CHUK	IKBKA \| IKK-alpha \| IKK1 \| IKKA \| NFKBIKA \| TCF16	conserved helix-loop-helix ubiquitous kinase	Ikk-alpha interacts with NIK. This interaction was modeled on a demonstrated interaction between human IKK-alpha and NIK from an unspecified species.	BIND	9346485
CSDA	CSDA1 \| DBPA \| ZONAB	cold shock domain protein A	-	HPRD	14743216
DHX9	DDX9 \| LKP \| NDHII \| RHA	DEAH (Asp-Glu-Ala-His) box polypeptide 9	-	HPRD	14743216
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	-	HPRD,BioGRID	11116146
EXOSC10	PM-Scl \| PM/Scl-100 \| PMSCL \| PMSCL2 \| RRP6 \| Rrp6p \| p2 \| p3 \| p4	exosome component 10	-	HPRD	14743216
GLUD1	GDH \| GDH1 \| GLUD \| MGC132003	glutamate dehydrogenase 1	-	HPRD	14743216
GRWD1	GRWD \| KIAA1942 \| RRB1 \| WDR28	glutamate-rich WD repeat containing 1	-	HPRD	14743216
HNRNPA1	HNRPA1 \| MGC102835	heterogeneous nuclear ribonucleoprotein A1	-	HPRD	14743216
HNRNPM	DKFZp547H118 \| HNRNPM4 \| HNRPM \| HNRPM4 \| HTGR1 \| NAGR1	heterogeneous nuclear ribonucleoprotein M	-	HPRD	14743216
HSPA8	HSC54 \| HSC70 \| HSC71 \| HSP71 \| HSP73 \| HSPA10 \| LAP1 \| MGC131511 \| MGC29929 \| NIP71	heat shock 70kDa protein 8	-	HPRD	14743216
IKBKAP	DKFZp781H1425 \| DYS \| ELP1 \| FD \| FLJ12497 \| IKAP \| IKI3 \| TOT1	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	-	HPRD,BioGRID	9751059
IKBKAP	DKFZp781H1425 \| DYS \| ELP1 \| FD \| FLJ12497 \| IKAP \| IKI3 \| TOT1	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	IKAP interacts with NIK.	BIND	9751059
IKBKB	FLJ40509 \| IKK-beta \| IKK2 \| IKKB \| MGC131801 \| NFKBIKB	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	IKK-beta interacts with NIK. This interaction was modeled on a demonstrated interaction between human IKK-beta and NIK from an unspecified species.	BIND	9346485
IKBKB	FLJ40509 \| IKK-beta \| IKK2 \| IKKB \| MGC131801 \| NFKBIKB	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	-	HPRD,BioGRID	9346485
IKBKG	AMCBX1 \| FIP-3 \| FIP3 \| Fip3p \| IKK-gamma \| IP \| IP1 \| IP2 \| IPD2 \| NEMO	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma	-	HPRD,BioGRID	9927690
MAP3K14	FTDCR1B \| HS \| HSNIK \| NIK	mitogen-activated protein kinase kinase kinase 14	-	HPRD,BioGRID	10887201
MAP3K7	TAK1 \| TGF1a	mitogen-activated protein kinase kinase kinase 7	-	HPRD,BioGRID	10094049
MAP3K8	COT \| EST \| ESTF \| FLJ10486 \| TPL2 \| Tpl-2 \| c-COT	mitogen-activated protein kinase kinase kinase 8	-	HPRD,BioGRID	10072079
NFKB2	LYT-10 \| LYT10	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	-	HPRD,BioGRID	11239468
NFKBIA	IKBA \| MAD-3 \| NFKBI	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	Reconstituted Complex	BioGRID	9751059
NPM1	B23 \| MGC104254 \| NPM	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	-	HPRD	14743216
PELI3	MGC35521	pellino homolog 3 (Drosophila)	-	HPRD	12874243
RIPK1	FLJ39204 \| RIP \| RIP1	receptor (TNFRSF)-interacting serine-threonine kinase 1	-	HPRD,BioGRID	11116146
RPL10A	Csa-19 \| NEDD6	ribosomal protein L10a	-	HPRD	14743216
RPL18	-	ribosomal protein L18	-	HPRD	14743216
RPL24	-	ribosomal protein L24	-	HPRD	14743216
RPL3	MGC104284 \| TARBP-B	ribosomal protein L3	-	HPRD	14743216
RPL32	PP9932	ribosomal protein L32	-	HPRD	14743216
RPL35	-	ribosomal protein L35	-	HPRD	14743216
RPL8	-	ribosomal protein L8	-	HPRD	14743216
RPS3	FLJ26283 \| FLJ27450 \| MGC87870	ribosomal protein S3	-	HPRD	14743216
RRP12	DKFZp762P1116 \| FLJ20231 \| KIAA0690	ribosomal RNA processing 12 homolog (S. cerevisiae)	-	HPRD	14743216
RUVBL2	CGI-46 \| ECP51 \| INO80J \| REPTIN \| RVB2 \| TIH2 \| TIP48 \| TIP49B	RuvB-like 2 (E. coli)	-	HPRD	14743216
TRAF1	EBI6 \| MGC:10353	TNF receptor-associated factor 1	-	HPRD,BioGRID	11278268
TRAF1	EBI6 \| MGC:10353	TNF receptor-associated factor 1	NIK interacts with TRAF1. This interaction was modeled on a demonstrated interaction between human NIK and TRAF1 from an unspecified species.	BIND	9275204
TRAF2	MGC:45012 \| TRAP \| TRAP3	TNF receptor-associated factor 2	-	HPRD,BioGRID	9020361\|11278268
TRAF2	MGC:45012 \| TRAP \| TRAP3	TNF receptor-associated factor 2	NIK interacts with TRAF2. This interaction was modeled on a demonstrated interaction between human NIK and TRAF2 from an unspecified species.	BIND	9275204
TRAF3	CAP-1 \| CD40bp \| CRAF1 \| LAP1	TNF receptor-associated factor 3	-	HPRD,BioGRID	11278268
TRAF3	CAP-1 \| CD40bp \| CRAF1 \| LAP1	TNF receptor-associated factor 3	NIK interacts with TRAF3. This interaction was modeled on a demonstrated interaction between human NIK and TRAF3 from an unspecified species.	BIND	9275204
TRAF5	MGC:39780 \| RNF84	TNF receptor-associated factor 5	NIK interacts with TRAF5. This interaction was modeled on a demonstrated interaction between human NIK and TRAF5 from an unspecified species.	BIND	9275204
TRAF6	MGC:3310 \| RNF85	TNF receptor-associated factor 6	-	HPRD,BioGRID	11278268
TRAF6	MGC:3310 \| RNF85	TNF receptor-associated factor 6	NIK interacts with TRAF6. This interaction was modeled on a demonstrated interaction between human NIK and TRAF6 from an unspecified species.	BIND	9275204
TUBA3C	TUBA2 \| bA408E5.3	tubulin, alpha 3c	-	HPRD	14743216
TUBB2B	DKFZp566F223 \| FLJ98847 \| MGC8685 \| TUBB-PARALOG \| bA506K6.1	tubulin, beta 2B	-	HPRD	14743216

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG APOPTOSIS	88	62	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG INTESTINAL IMMUNE NETWORK FOR IGA PRODUCTION	48	36	All SZGR 2.0 genes in this pathway
KEGG EPITHELIAL CELL SIGNALING IN HELICOBACTER PYLORI INFECTION	68	44	All SZGR 2.0 genes in this pathway
BIOCARTA CD40 PATHWAY	15	13	All SZGR 2.0 genes in this pathway
BIOCARTA RNA PATHWAY	10	9	All SZGR 2.0 genes in this pathway
BIOCARTA HIVNEF PATHWAY	58	43	All SZGR 2.0 genes in this pathway
BIOCARTA DEATH PATHWAY	33	24	All SZGR 2.0 genes in this pathway
BIOCARTA KERATINOCYTE PATHWAY	46	38	All SZGR 2.0 genes in this pathway
BIOCARTA MAPK PATHWAY	87	68	All SZGR 2.0 genes in this pathway
BIOCARTA NTHI PATHWAY	24	20	All SZGR 2.0 genes in this pathway
BIOCARTA NFKB PATHWAY	23	19	All SZGR 2.0 genes in this pathway
BIOCARTA IL1R PATHWAY	33	29	All SZGR 2.0 genes in this pathway
BIOCARTA TALL1 PATHWAY	15	15	All SZGR 2.0 genes in this pathway
BIOCARTA应力路径	25	18	All SZGR 2.0 genes in this pathway
BIOCARTA TNFR2 PATHWAY	18	15	All SZGR 2.0 genes in this pathway
BIOCARTA TOLL PATHWAY	37	31	All SZGR 2.0 genes in this pathway
PID TCR PATHWAY	66	51	All SZGR 2.0 genes in this pathway
PID CD40 PATHWAY	31	26	All SZGR 2.0 genes in this pathway
PID AVB3 OPN PATHWAY	31	29	All SZGR 2.0 genes in this pathway
PID CD8 TCR PATHWAY	53	42	All SZGR 2.0 genes in this pathway
PID HIV NEF PATHWAY	35	26	All SZGR 2.0 genes in this pathway
REACTOME CD28 CO STIMULATION	32	26	All SZGR 2.0 genes in this pathway
REACTOME COSTIMULATION BY THE CD28 FAMILY	63	48	All SZGR 2.0 genes in this pathway
REACTOME CD28 DEPENDENT PI3K AKT SIGNALING	22	18	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME ADAPTIVE IMMUNE SYSTEM	539	350	All SZGR 2.0 genes in this pathway
ZHONG RESPONSE TO AZACITIDINE AND TSA UP	183	119	All SZGR 2.0 genes in this pathway
HOOI ST7 TARGETS UP	94	57	All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING UP	176	123	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 48HR DN	64	39	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 96HR DN	75	50	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN	378	231	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP	239	157	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
SCHEIDEREIT IKK INTERACTING PROTEINS	58	45	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN	411	249	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 120 HELA	69	47	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 60 MCF10A	39	24	All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 120 MCF10A	65	44	All SZGR 2.0 genes in this pathway
STANELLE E2F1 TARGETS	29	20	All SZGR 2.0 genes in this pathway
NATSUME RESPONSE TO INTERFERON BETA UP	71	49	All SZGR 2.0 genes in this pathway
MURAKAMI UV RESPONSE 6HR DN	21	13	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
MURAKAMI UV RESPONSE 24HR	20	13	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN	120	81	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP	439	257	All SZGR 2.0 genes in this pathway
FIRESTEIN CTNNB1 PATHWAY AND PROLIFERATION	9	5	All SZGR 2.0 genes in this pathway
FIRESTEIN CTNNB1 PATHWAY	33	23	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
LINDSTEDT DENDRITIC CELL MATURATION B	53	36	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 UP	338	225	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF DN	235	144	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN	245	150	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA DN	267	160	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES DN	210	141	All SZGR 2.0 genes in this pathway
MURAKAMI UV RESPONSE 1HR UP	17	10	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 1HR UP	34	26	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA VIA KDM3A	53	34	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-130/301	1013	1019	m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-155	1247	1254	1A,m8	hsa-miR-155	UUAAUGCUAAUCGUGAUAGGGG
miR-17-5p/20/93.mr/106/519.d	1034	1040	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
				hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-19	1012	1018	m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	1012	1018	m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-27	1260	1266	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1260	1266	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-93.hd/291-3p/294/295/302/372/373/520	1033	1039	m8	hsa-miR-93^brain	AAAGUGCUGUUCGUGCAGGUAG
				hsa-miR-302a	UAAGUGCUUCCAUGUUUUGGUGA
				hsa-miR-302b	UAAGUGCUUCCAUGUUUUAGUAG
				hsa-miR-302c	UAAGUGCUUCCAUGUUUCAGUGG
				hsa-miR-302d	UAAGUGCUUCCAUGUUUGAGUGU
				hsa-miR-372	AAAGUGCUGCGACAUUUGAGCGU
				hsa-miR-373	GAAGUGCUUCGAUUUUGGGGUGU
				hsa-miR-520e	AAAGUGCUUCCUUUUUGAGGG
				hsa-miR-520a	AAAGUGCUUCCCUUUGGACUGU
				hsa-miR-520b	AAAGUGCUUCCUUUUAGAGGG
				hsa-miR-520c	AAAGUGCUUCCUUUUAGAGGGUU
				hsa-miR-520d	AAAGUGCUUCUCUUUGGUGGGUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhere看到深圳的列表相关的microrna。
大脑:microrna的表达大脑基于on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.

Gene Page:MAP3K14