Gene Page:BRSK2

Summary?
GeneID 9024
Symbol BRSK2
Synonyms C11orf7|PEN11B|SAD1|SADA|STK29
Description BR serine/threonine kinase 2
Reference MIM:609236|HGNC:HGNC:11405|Ensembl:ENSG00000174672|Vega:OTTHUMG00000167089
Gene type protein-coding
Map location 11p15.5
Pascal p-value 0.01
Sherlock p-value 0.84
Fetal beta 0.009
DMG 2 (# studies)
eGene Myers' cis & trans
Support CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 4
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 4
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg07652408 11 1459488 BRSK2 3.89E-5 0.356 0.02 DMG:Wockner_2014
cg06787104 11 1457119 BRSK2 2.276E-4 -0.218 0.036 DMG:Wockner_2014
cg06300961 11 1459507 BRSK2 5.85E-4 0.291 0.049 DMG:Wockner_2014
cg14021073 11 1410385 BRSK2 1.63E-8 -0.01 6.01E-6 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs6733654 chr2 1963270 BRSK2 9024 0.04 trans
rs9637082 chr21 21213235 BRSK2 9024 2.545E-4 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MPHOSPH8 0.89 0.90
GOLGB1 0.89 0.90
ANKRD26 0.87 0.89
CDC42BPA 0.86 0.88
KIF21A 0.85 0.87
GOLGA4 0.85 0.87
EEA1 0.84 0.87
FMR1 0.84 0.86
DST 0.83 0.84
KIF3A 0.83 0.85
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
ENHO -0.64 -0.69
METRN -0.55 -0.56
AF347015.21 -0.55 -0.49
C1orf61 -0.55 -0.62
AF347015.31 -0.54 -0.52
HIGD1B -0.54 -0.53
VAMP5 -0.53 -0.54
IFI27 -0.53 -0.51
CLDN5 -0.52 -0.56
C1orf54 -0.52 -0.55

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0000287 magnesium ion binding IDA 14976552
GO:0005524 ATP binding IDA 14976552
GO:0004674 protein serine/threonine kinase activity IDA 14976552
GO:0004674 protein serine/threonine kinase activity IEA -
GO:0016740 transferase activity IEA -
GO:0016301 kinase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0030182 neuron differentiation ISS neuron (GO term level: 8) -
GO:0006468 protein amino acid phosphorylation IDA 14976552
GO:0030010 establishment of cell polarity ISS -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID LKB1 PATHWAY 47 37 All SZGR 2.0 genes in this pathway
DARWICHE皮肤肿瘤促进剂DN 185 115 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW DN 165 107 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH DN 180 110 All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA DN 181 107 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN 164 111 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN 504 323 All SZGR 2.0 genes in this pathway
CAMPS COLON CANCER COPY NUMBER UP 92 45 All SZGR 2.0 genes in this pathway
HANN RESISTANCE TO BCL2 INHIBITOR UP 36 24 All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871 505 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857 456 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A 898 516 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-22 37 43 m8 hsa-miR-22brain AAGCUGCCAGUUGAAGAACUGU