SZGR2 - Beplay体育中心

Summary?

GeneID	90627
Symbol	STARD13
Synonyms	ARHGAP37\|DLC2\|GT650\|LINC00464
Description	StAR related lipid transfer domain containing 13
Reference	MIM:609866\|HGNC:HGNC:19164\|Ensembl:ENSG00000133121\|HPRD:11607\|Vega:OTTHUMG00000016708
Gene type	protein-coding
Map location	13q13.1
Pascal p-value	0.004
Sherlock p-value	0.439
Fetal beta	-1.796
DMG	2 (# studies)
eGene	Nucleus accumbens basal ganglia
Support	CompositeSet Ascano FMRP targets

Gene in Data Sources

基因集名称	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
STARD13	chr13	33684161	C	T	NM_001243476 NM_052851 NM_178006 NM_178007	p.931V>I p.848V>I p.966V>I p.958V>I	missense missense missense missense			Schizophrenia	DNM:Fromer_2014

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg24469742	13	33773155	STARD13	5.368E-4	0.416	0.048	DMG:Wockner_2014
cg04240267	13	34116871	STARD13	7.74E-11	-0.016	4.34E-7	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC:分皮质区域;SM:感觉运动区域s; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	去的术语	Evidence	Neuro keywords	PubMed ID
GO:0005096	GTPase activator activity	IEA		-
GO:0005515	protein binding	新闻学会		14697242
Biological process	去的术语	Evidence	Neuro keywords	PubMed ID
GO:0007165	signal transduction	IEA		-
GO:0045786	negative regulation of cell cycle	IEA		-
Cellular component	去的术语	Evidence	Neuro keywords	PubMed ID
GO:0005811	lipid particle	IEA		-
GO:0005622	intracellular	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0005739	mitochondrion	IEA		-
GO:0016020	membrane	IEA		-
GO:0034430	monolayer-surrounded lipid storage body outer lipid monolayer	IEA		-
GO:0031966	mitochondrial membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BAI2	-	brain-specific angiogenesis inhibitor 2	STARD13 (RhoGAP) interacts with BAI2.	BIND	14697242
BAI2	-	brain-specific angiogenesis inhibitor 2	-	HPRD,BioGRID	14697242
CNTN2	AXT \| DKFZp781D102 \| FLJ42746 \| MGC157722 \| TAG-1 \| TAX \| TAX1	contactin 2 (axonal)	Affinity Capture-Western	BioGRID	14697242
EPB41L1	4.1N \| DKFZp686H17242 \| KIAA0338 \| MGC11072	erythrocyte membrane protein band 4.1-like 1	STARD13 (RhoGAP) interacts with EPB41L1 (KIAA0338).	BIND	14697242
EPB41L1	4.1N \| DKFZp686H17242 \| KIAA0338 \| MGC11072	erythrocyte membrane protein band 4.1-like 1	-	HPRD,BioGRID	14697242
HMGCR	-	3-hydroxy-3-methylglutaryl-Coenzyme A reductase	-	HPRD,BioGRID	14697242
HMGCR	-	3-hydroxy-3-methylglutaryl-Coenzyme A reductase	STARD13 (RhoGAP) interacts with HMGCR (HMG CoA reductase).	BIND	14697242
HSP90AA1	FLJ31884 \| HSP86 \| HSP89A \| HSP90A \| HSP90N \| HSPC1 \| HSPCA \| HSPCAL1 \| HSPCAL4 \| HSPN \| Hsp89 \| Hsp90 \| LAP2	heat shock protein 90kDa alpha (cytosolic), class A member 1	Two-hybrid	BioGRID	14697242
HSP90AB1	D6S182 \| FLJ26984 \| HSP90-BETA \| HSP90B \| HSPC2 \| HSPCB	heat shock protein 90kDa alpha (cytosolic), class B member 1	STARD13 (RhoGAP) interacts with HSPCB.	BIND	14697242
HSP90AB1	D6S182 \| FLJ26984 \| HSP90-BETA \| HSP90B \| HSPC2 \| HSPCB	heat shock protein 90kDa alpha (cytosolic), class B member 1	-	HPRD	14697242
ITPR1	INSP3R1 \| IP3R \| IP3R1 \| SCA15 \| SCA16	inositol 1,4,5-triphosphate receptor, type 1	STARD13 (RhoGAP) interacts with ITPR1.	BIND	14697242
ITPR1	INSP3R1 \| IP3R \| IP3R1 \| SCA15 \| SCA16	inositol 1,4,5-triphosphate receptor, type 1	Two-hybrid	BioGRID	14697242
KIF1B	CMT2 \| CMT2A \| CMT2A1 \| FLJ23699 \| HMSNII \| KIAA0591 \| KIAA1448 \| KLP \| MGC134844	kinesin family member 1B	-	HPRD,BioGRID	14697242
KIF1B	CMT2 \| CMT2A \| CMT2A1 \| FLJ23699 \| HMSNII \| KIAA0591 \| KIAA1448 \| KLP \| MGC134844	kinesin family member 1B	STARD13 (RhoGAP) interacts with KIF1B.	BIND	14697242
SMARCD3	BAF60C \| CRACD3 \| MGC111010 \| Rsc6p	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3	STARD13 (RhoGAP) interacts with an unspecified isoform of SMARCD3 (SWI/SNF).	BIND	14697242
SMARCD3	BAF60C \| CRACD3 \| MGC111010 \| Rsc6p	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3	Two-hybrid	BioGRID	14697242
TAX1BP1	CALCOCO3 \| T6BP \| TXBP151	Tax1 (human T-cell leukemia virus type I) binding protein 1	STARD13 (RhoGAP) interacts with TAX1BP1 (Tax1BP).	BIND	14697242
TAX1BP1	CALCOCO3 \| T6BP \| TXBP151	Tax1 (human T-cell leukemia virus type I) binding protein 1	-	HPRD,BioGRID	14697242
TRIM58	BIA2 \| DKFZp434C091	tripartite motif-containing 58	Two-hybrid	BioGRID	14697242
TUBA1A	B-ALPHA-1 \| FLJ25113 \| LIS3 \| TUBA3	tubulin, alpha 1a	Affinity Capture-Western Two-hybrid	BioGRID	14697242
TUBA1B	K-ALPHA-1	tubulin, alpha 1b	STARD13 (RhoGAP) interacts with K-ALPHA-1 (alpha-tubulin).	BIND	14697242
TUBA4A	FLJ30169 \| H2-ALPHA \| TUBA1	tubulin, alpha 4a	-	HPRD	14697242

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME SIGNALING BY RHO GTPASES	113	81	All SZGR 2.0 genes in this pathway
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN	169	118	All SZGR 2.0 genes in this pathway
SOTIRIOU BREAST CANCER GRADE 1 VS 3 DN	52	34	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN	537	339	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN	232	154	All SZGR 2.0 genes in this pathway
VANHARANTA UTERINE FIBROID UP	45	26	All SZGR 2.0 genes in this pathway
ODONNELL METASTASIS UP	82	58	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS DN	124	79	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 UP	256	159	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 DN	169	102	All SZGR 2.0 genes in this pathway
ZHANG TARGETS OF EWSR1 FLI1 FUSION	88	68	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP	268	157	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN	258	160	All SZGR 2.0 genes in this pathway
MASSARWEH RESPONSE TO ESTRADIOL	61	47	All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS	425	261	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR DN	254	158	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D	882	506	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR年代tart	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	2345	2351	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-125/351	24	31	1A,m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
				hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
				hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
				hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-130/301	1010	1016	m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-148/152	1011	1018	1A,m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-182	2404	2410	m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-324-5p	2029	2035	m8	hsa-miR-324-5p	CGCAUCCCCUAGGGCAUUGGUGU
miR-369-3p	2334	2340	1A	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-374	2334	2340	m8	hsa - mir - 374	UUAUAAUACAACCUGAUAAGUG
miR-410	399	405	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-9	560	567	1A,m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-9	560	567	1A,m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.

Gene Page:STARD13