Gene Page:TMEM55B

Summary?
GeneID 90809
Symbol TMEM55B
Synonyms C14orf9
Description transmembrane protein 55B
Reference MIM:609865|HGNC:HGNC:19299|Ensembl:ENSG00000165782|HPRD:12660|Vega:OTTHUMG00000029545
Gene type protein-coding
Map location 14q11.2
Pascal p-value 0.718
Sherlock p-value 0.775
Fetal beta -0.636
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
DNM:Guipponi_2014 Whole Exome Sequencing analysis 49 DNMs were identified by comparing the exome of 53 individuals with sporadic SCZ and of their non-affected parents
GSMA_I Genome scan meta-analysis Psr: 0.047

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
TMEM55B G A NM_001100814 p.V100V synonymous NA NA Schizophrenia DNM:Guipponi_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs921442 chr11 57920868 TMEM55B 90809 0.14 trans
rs9571716 chr13 67711344 TMEM55B 90809 0.14 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0016787 hydrolase activity IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005765 lysosomal membrane IEA -
GO:0005768 endosome IEA -
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -
GO:0031902 late endosome membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
SENESE HDAC3 TARGETS DN 536 332 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
JAERVINEN AMPLIFIED IN LARYNGEAL CANCER 40 24 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734 436 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION DN 517 309 All SZGR 2.0 genes in this pathway
CHIBA RESPONSE TO TSA 50 31 All SZGR 2.0 genes in this pathway
GRADE COLON VS RECTAL CANCER DN 56 36 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
LINSLEY MIR16 TARGETS 206 127 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-1/206 327 334 1A,m8 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZ UGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
miR-142-3p 50 56 m8 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA