Gene Page:MAGI1

Summary?
GeneID 9223
Symbol MAGI1
Synonyms AIP-3|AIP3|BAIAP1|BAP-1|BAP1|MAGI-1|Magi1d|TNRC19|WWP3
Description membrane associated guanylate kinase, WW and PDZ domain containing 1
Reference MIM:602625|HGNC:HGNC:946|Ensembl:ENSG00000151276|HPRD:04020|Vega:OTTHUMG00000157554
Gene type protein-coding
Map location 3p14.1
Pascal p-value 0.651
Sherlock p-value 0.843
Fetal beta -1.107
eGene Putamen basal ganglia
Myers' cis & trans
Meta

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association A combined odds ratio method (Sun et al. 2008), association studies 2 Link to SZGene
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16955618 chr15 29937543 MAGI1 9223 0.18 trans
rs12488399 3 65216032 MAGI1 ENSG00000151276.19 5.29466E-7 0.01 808193 gtex_brain_putamen_basal
rs12488533 3 65216274 MAGI1 ENSG00000151276.19 3.00438E-7 0.01 807951 gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
DSP 0.87 0.66
CFH 0.86 0.61
OGN 0.86 0.59
GJB2 0.85 0.46
SCARA5 0.85 0.61
BNC2 0.83 0.48
SIX1 0.81 0.46
SIX2 0.79 0.36
SLC47A1 0.79 0.60
FOXC2 0.79 0.49
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
HES4 -0.24 -0.39
AC217773.2 -0.21 -0.30
FAM128A -0.21 -0.34
MRPL41 -0.20 -0.10
C1orf61 -0.20 -0.27
NUDT8 -0.19 -0.30
NBR2 -0.19 -0.14
C7orf55 -0.19 -0.26
C9orf142 -0.18 -0.29
C16orf14 -0.18 -0.11

Section III. Gene Ontology annotation

Molecular function 去后m Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0005524 ATP binding IEA -
GO:0008022 protein C-terminus binding TAS 9647739
Biological process 去后m Evidence Neuro keywords PubMed ID
GO:0007155 cell adhesion TAS 9647739
GO:0006461 protein complex assembly NAS 9647739
GO:0007166 cell surface receptor linked signal transduction TAS 9647739
Cellular component 去后m Evidence Neuro keywords PubMed ID
GO:0005923 tight junction IEA Brain (GO term level: 10) -
GO:0005886 plasma membrane TAS 9647739

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ACCN3 ASIC3 | DRASIC | SLNAC1 | TNaC1 amiloride-sensitive cation channel 3 - HPRD,BioGRID 15317815
ACCN3 ASIC3 | DRASIC | SLNAC1 | TNaC1 amiloride-sensitive cation channel 3 ASIC3 interacts with MAGI-1B. BIND 15317815
ACTN4 ACTININ-4 | DKFZp686K23158 | FSGS | FSGS1 actinin, alpha 4 - HPRD,BioGRID 12042308
ATN1 B37 | D12S755E | DRPLA | NOD atrophin 1 Atrophin-1 interacts with AIP-3. BIND 9647693
ATN1 B37 | D12S755E | DRPLA | NOD atrophin 1 - HPRD,BioGRID 9647693
BAI1 FLJ41988 brain-specific angiogenesis inhibitor 1 - HPRD,BioGRID 9647739
BZW1 BZAP45 | KIAA0005 | Nbla10236 基本亮氨酸拉链和W2域1 Affinity Capture-MS BioGRID 17353931
CDH1 Arc-1 | CD324 | CDHE | ECAD | LCAM | UVO 钙粘蛋白1 1型钙粘蛋白(上皮) Affinity Capture-Western BioGRID 10772923
CTNNB1 CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 catenin (cadherin-associated protein), beta 1, 88kDa Affinity Capture-Western
Reconstituted Complex
Two-hybrid		 BioGRID 10772923
DLL1 DELTA1 | DL1 | Delta delta-like 1 (Drosophila) Delta1 interacts with MAGI-1. BIND 15509766
FCHSD2 KIAA0769 | NWK | SH3MD3 FCH and double SH3 domains 2 Affinity Capture-Western
Reconstituted Complex
Two-hybrid		 BioGRID 14627983
IL6R CD126 | IL-6R-1 | IL-6R-alpha | IL6RA | MGC104991 interleukin 6 receptor - HPRD 9169421
LRP2 DBS | gp330 low density lipoprotein-related protein 2 - HPRD,BioGRID 11274227
NET1 ARHGEF8 | NET1A neuroepithelial cell transforming 1 - HPRD,BioGRID 11350080
RASA1 CM-AVM | CMAVM | DKFZp434N071 | GAP | PKWS | RASA | RASGAP | p120GAP | p120RASGAP RAS p21 protein activator (GTPase activating protein) 1 - HPRD 9169421
SFN YWHAS stratifin Affinity Capture-MS BioGRID 15778465
SYNPO KIAA1029 synaptopodin - HPRD,BioGRID 12042308
TP53BP2 53BP2 | ASPP2 | BBP | PPP1R13A | p53BP2 tumor protein p53 binding protein, 2 - HPRD 9169421
WBP1 MGC15305 | WBP-1 WW domain binding protein 1 Protein-peptide BioGRID 9169421
WBP2 MGC18269 | WBP-2 WW domain binding protein 2 Protein-peptide BioGRID 9169421


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG TIGHT JUNCTION 134 86 All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 TARGETS DN 158 102 All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP 269 146 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN 805 505 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537 339 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
KIM MYC AMPLIFICATION TARGETS UP 201 127 All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475 313 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA MS UP 48 32 All SZGR 2.0 genes in this pathway
LEIN ASTROCYTE MARKERS 42 35 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN 366 257 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A 898 516 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP 271 165 All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF 516 308 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-101 1455 1462 1A,m8 hsa-miR-101 UACAGUACUGUGAUAACUGAAG
miR-153 1929 1935 m8 hsa-miR-153 UUGCAUAGUCACAAAAGUGA
miR-182 237 244 1A,m8 hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-185 328 334 m8 hsa-miR-185brain UGGAGAGAAAGGCAGUUC
miR-188 255 262 1A,m8 hsa-miR-188 CAUCCCUUGCAUGGUGGAGGGU
miR-205 576 583 1A,m8 hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG
miR-23 1628 1634 m8 hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-24 1315 1322 1A,m8 hsa-miR-24SZ UGGCUCAGUUCAGCAGGAACAG
miR-320 1959 1965 1A hsa-miR-320 AAAAGCUGGGUUGAGAGGGCGAA
miR-323 1628 1634 1A hsa-miR-323brain GCACAUUACACGGUCGACCUCU
miR-34b 1306 1313 1A,m8 hsa-miR-34b UAGGCAGUGUCAUUAGCUGAUUG
miR-381 1587 1594 1A,m8 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
miR-411 26 32 m8 hsa-miR-411 AACACGGUCCACUAACCCUCAGU
miR-496 1707 1713 1A hsa-miR-496 AUUACAUGGCCAAUCUC
miR-96 238 244 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC