Gene Page:SLC9A3R1

Summary?
GeneID 9368
Symbol SLC9A3R1
Synonyms EBP50|NHERF|NHERF-1|NHERF1|NPHLOP2
Description SLC9A3 regulator 1
Reference MIM:604990|HGNC:HGNC:11075|Ensembl:ENSG00000109062|HPRD:05406|Vega:OTTHUMG00000178863
Gene type protein-coding
Map location 17q25.1
Pascal p-value 0.991
Sherlock p-value 0.868
Fetal beta -1.397
DMG 1 (# studies)
eGene Cerebellar Hemisphere
Cerebellum
Myers' cis & trans
Meta
Support ION BALANCE
CompositeSet

Gene in Data Sources
基因集名称 Method of gene set Description Info
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
DNM:Fromer_2014 Whole Exome Sequencing analysis This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0231

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
SLC9A3R1 chr17 72758193 A G NM_004252 p.162S>G missense Schizophrenia DNM:Fromer_2014

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg02976539 17 72757302 SLC9A3R1 2.465E-4 -0.41 0.037 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs2384957 chr17 72784629 SLC9A3R1 9368 0 cis
rs13397687 chr2 123655344 SLC9A3R1 9368 0.07 trans
rs13414989 chr2 204991337 SLC9A3R1 9368 0.14 trans
rs9313483 chr5 169448229 SLC9A3R1 9368 0.07 trans
rs9313484 chr5 169448319 SLC9A3R1 9368 0 trans
rs794099 chr6 164690612 SLC9A3R1 9368 0.13 trans
rs12545427 chr8 74954879 SLC9A3R1 9368 0.07 trans
rs6472816 chr8 74961543 SLC9A3R1 9368 0.16 trans
rs11216730 chr11 117918701 SLC9A3R1 9368 0.15 trans
rs17504394 chr13 30646519 SLC9A3R1 9368 0.15 trans
rs2384957 chr17 72784629 SLC9A3R1 9368 0.12 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
GYG2 0.69 0.65
AC063977.1 0.66 0.72
DNER 0.63 0.71
C15orf39 0.63 0.62
ORAI2 0.63 0.76
RADIL 0.63 0.63
MAP2K3 0.60 0.66
LRRN2 0.60 0.72
DCLK2 0.60 0.62
CHST2 0.60 0.70
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.31 -0.35 -0.43
AF347015.21 -0.35 -0.45
MT-CO2 -0.34 -0.42
AF347015.8 -0.34 -0.41
AF347015.2 -0.34 -0.41
AF347015.27 -0.33 -0.39
AF347015.33 -0.33 -0.38
MT-CYB -0.32 -0.39
AF347015.15 -0.31 -0.37
MT-ATP8 -0.31 -0.41

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding 新闻学会 11285285|12471024
GO:0030165 PDZ domain binding 新闻学会 16236806
GO:0031698 beta-2 adrenergic receptor binding 新闻学会 9560162
生物过程 去的术语 Evidence Neuro keywords PubMed ID
GO:0006461 protein complex assembly TAS 9430655
GO:0016055 Wnt receptor signaling pathway IEA -
GO:0030643 cellular phosphate ion homeostasis IEA -
GO:0032415 regulation of sodium:hydrogen antiporter activity NAS 9560162
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0042995 cell projection IEA axon (GO term level: 4) -
GO:0012505 endomembrane system IEA -
GO:0016020 membrane IEA -
GO:0015629 actin cytoskeleton TAS 9430655
GO:0016324 apical plasma membrane IEA -

第四部分,注释蛋白质间交互作用

Interactors Aliases B Official full name B Experimental Source PubMed ID
ABCC2 ABC30 | CMOAT | DJS | KIAA1010 | MRP2 | cMRP ATP-binding cassette, sub-family C (CFTR/MRP), member 2 - HPRD,BioGRID 12615054
ADRB2 ADRB2R | ADRBR | B2AR | BAR | BETA2AR adrenergic, beta-2-, receptor, surface - HPRD,BioGRID 9560162|9671706
ADRB2 ADRB2R | ADRBR | B2AR | BAR | BETA2AR adrenergic, beta-2-, receptor, surface PDZ domain of NHERF binds to the C-terminus of B2AR. BIND 9560162|9671706
|12621035
AKAP10 D-AKAP2 | MGC9414 | PRKA10 A kinase (PRKA) anchor protein 10 - HPRD 14531806
ATP6V1E1 ATP6E | ATP6E2 | ATP6V1E | P31 | Vma4 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 - HPRD 10748165
CFTR ABC35 | ABCC7 | CF | CFTR/MRP | MRP7 | TNR-CFTR | dJ760C5.1 cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) First PDZ domain of EBP50 binds to the C-terminus of CFTR. BIND 9671706|9677412
|10852925|12621035
CFTR ABC35 | ABCC7 | CF | CFTR/MRP | MRP7 | TNR-CFTR | dJ760C5.1 cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) - HPRD 9613608|9677412
|10852925
CFTR ABC35 | ABCC7 | CF | CFTR/MRP | MRP7 | TNR-CFTR | dJ760C5.1 cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) Affinity Capture-Western
in vitro
in vivo
Reconstituted Complex		 BioGRID 9613608|9671706
|9677412|10852925
|12471024|12615054
CLCN3 CLC3 | ClC-3 chloride channel 3 - HPRD,BioGRID 12471024
CNGA2 CNCA | CNCA1 | CNG2 | FLJ46312 | OCNC1 | OCNCALPHA | OCNCa cyclic nucleotide gated channel alpha 2 - HPRD 14604981
CTNNB1 CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 catenin (cadherin-associated protein), beta 1, 88kDa - HPRD,BioGRID 12830000
EZR CVIL | CVL | DKFZp762H157 | FLJ26216 | MGC1584 | VIL2 ezrin - HPRD,BioGRID 9314537
GNAQ G-ALPHA-q | GAQ guanine nucleotide binding protein (G protein), q polypeptide - HPRD,BioGRID 12193606
GNB2L1 Gnb2-rs1 | H12.3 | HLC-7 | PIG21 | RACK1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 Affinity Capture-Western BioGRID 11956211
KCNJ1 KIR1.1 | ROMK | ROMK1 potassium inwardly-rectifying channel, subfamily J, member 1 - HPRD,BioGRID 14604981
KCNJ1 KIR1.1 | ROMK | ROMK1 potassium inwardly-rectifying channel, subfamily J, member 1 An unspecified isoform of ROMK interacts with NHERF-1. This interaction was modeled on a demonstrated interaction between Rat ROMK2 and Human NHERF-1. BIND 14604981
LHCGR FLJ41504 | LCGR | LGR2 | LH/CG-R | LH/CGR | LHR | LHRHR | LSH-R luteinizing hormone/choriogonadotropin receptor hLHR interacts with EBP50. BIND 14507927
MSN - moesin moesin interacts with hNHE-RF. BIND 9430655
MSN - moesin - HPRD,BioGRID 9430655
NF2 ACN | BANF | SCH neurofibromin 2 (merlin) - HPRD,BioGRID 9430655
NF2 ACN | BANF | SCH neurofibromin 2 (merlin) Merlin interacts with hNHE-RF BIND 9430655
NOS2 HEP-NOS | INOS | NOS | NOS2A nitric oxide synthase 2, inducible - HPRD,BioGRID 12080081
OPRK1 KOR | OPRK opioid receptor, kappa 1 - HPRD,BioGRID 12004055
OPRK1 KOR | OPRK opioid receptor, kappa 1 - HPRD 15070904
P2RY1 P2Y1 purinergic receptor P2Y, G-protein coupled, 1 NHERF interacts with P2Y1R. BIND 9671706
P2RY1 P2Y1 purinergic receptor P2Y, G-protein coupled, 1 - HPRD,BioGRID 9671706
PAG1 CBP | FLJ37858 | MGC138364 | PAG phosphoprotein associated with glycosphingolipid microdomains 1 - HPRD,BioGRID 11684085
PDGFRA CD140A | MGC74795 | PDGFR2 | Rhe-PDGFRA platelet-derived growth factor receptor, alpha polypeptide - HPRD,BioGRID 11046132|11882663
PDGFRB CD140B | JTK12 | PDGF-R-beta | PDGFR | PDGFR1 platelet-derived growth factor receptor, beta polypeptide - HPRD,BioGRID 11046132
PDZK1 CAP70 | CLAMP | NHERF3 | PDZD1 PDZ domain containing 1 Reconstituted Complex
Two-hybrid		 BioGRID 14531806
PIK3CA MGC142161 | MGC142163 | PI3K | p110-alpha phosphoinositide-3-kinase, catalytic, alpha polypeptide Reconstituted Complex BioGRID 12954600
PLCB1 FLJ45792 | PI-PLC | PLC-154 | PLC-I | PLC154 phospholipase C, beta 1 (phosphoinositide-specific) - HPRD,BioGRID 10980202
PLCB2 FLJ38135 phospholipase C, beta 2 - HPRD 10980202
PTH1R MGC138426 | MGC138452 | PTHR | PTHR1 parathyroid hormone 1 receptor - HPRD,BioGRID 12075354
RDX DFNB24 radixin Radixin interacts with hNHE-RF. This interaction was modeled on a demonstrated interaction between chicken radixin and human hNHE-RF. BIND 9430655
RDX DFNB24 radixin - HPRD 9430655|12499563
SLC4A8 DKFZp761B2318 | FLJ46462 | NBC3 solute carrier family 4, sodium bicarbonate cotransporter, member 8 - HPRD,BioGRID 12444018
SLC9A3 MGC126718 | MGC126720 | NHE3 solute carrier family 9 (sodium/hydrogen exchanger), member 3 - HPRD,BioGRID 14580213
SLC9A3R1 EBP50 | NHERF | NHERF1 | NPHLOP2 solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 Far Western
Reconstituted Complex		 BioGRID 11046132|15070904
TBC1D10A EPI64 | TBC1D10 | dJ130H16.1 | dJ130H16.2 TBC1 domain family, member 10A - HPRD,BioGRID 11285285
TRPC5 TRP5 transient receptor potential cation channel, subfamily C, member 5 - HPRD 10980202
YAP1 YAP | YAP2 | YAP65 | YKI Yes-associated protein 1, 65kDa - HPRD,BioGRID 10562288
YES1 HsT441 | P61-YES | Yes | c-yes v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 Reconstituted Complex BioGRID 10562288


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BIOCARTA CFTR PATHWAY 12 11 All SZGR 2.0 genes in this pathway
WNT SIGNALING 89 71 All SZGR 2.0 genes in this pathway
PID TXA2PATHWAY 57 43 All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY 129 103 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN 526 357 All SZGR 2.0 genes in this pathway
ZHONG RESPONSE TO AZACITIDINE AND TSA UP 183 119 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP 380 215 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP 450 256 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN 126 86 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 2 DN 77 46 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN 162 116 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN 378 231 All SZGR 2.0 genes in this pathway
WANG ESOPHAGUS CANCER VS NORMAL DN 101 66 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS DN 62 44 All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL 330 217 All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL 330 215 All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE UP 134 93 All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER 747 453 All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL DN 114 58 All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 UP 209 139 All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 AND HIF1A DN 103 71 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957 597 All SZGR 2.0 genes in this pathway
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN 206 136 All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON 335 181 All SZGR 2.0 genes in this pathway
UEDA PERIFERAL CLOCK 169 111 All SZGR 2.0 genes in this pathway
STOSSI RESPONSE TO ESTRADIOL 50 35 All SZGR 2.0 genes in this pathway
LEI MYB TARGETS 318 215 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR UP 225 139 All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN 287 208 All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS UP 113 71 All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE 246 153 All SZGR 2.0 genes in this pathway
里他莫昔芬耐了 66 44 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B UP 172 109 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701 446 All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN 546 362 All SZGR 2.0 genes in this pathway
布卢姆响应E TO SALIRASIB DN 342 220 All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS DN 210 128 All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 UP 167 99 All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE 200 115 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
COULOUARN TEMPORAL TGFB1 SIGNATURE DN 138 99 All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION 368 247 All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS UP 66 43 All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS DN 207 139 All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN 374 217 All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP 229 149 All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP 324 193 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP 211 131 All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP 281 183 All SZGR 2.0 genes in this pathway
VANDESLUIS COMMD1 TARGETS GROUP 3 UP 89 50 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP 682 433 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL DN 428 246 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-339 404 410 m8 hsa-miR-339 UCCCUGUCCUCCAGGAGCUCA