Gene Page:NRXN3

Summary?
GeneID 9369
Symbol NRXN3
Synonyms C14orf60
Description neurexin 3
裁判erence MIM:600567|HGNC:HGNC:8010|Ensembl:ENSG00000021645|HPRD:08989|Vega:OTTHUMG00000171502
Gene type protein-coding
Map location 14q31
Sherlock p-value 0.224
Fetal beta -2.391
eGene Myers' cis & trans
Support CELL ADHESION AND TRANSSYNAPTIC SIGNALING
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16829545 chr2 151977407 NRXN3 9369 7.424E-7 trans
rs7584986 chr2 184111432 NRXN3 9369 0.13 trans
rs2393316 chr10 59333070 NRXN3 9369 0.19 trans
rs16955618 chr15 29937543 NRXN3 9369 6.938E-8 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
PADI2 0.78 0.80
ICAM1 0.77 0.71
KCNJ10 0.76 0.76
FOXF1 0.75 0.66
C5orf4 0.75 0.83
TJP2 0.74 0.76
KANK1 0.74 0.70
APOLD1 0.74 0.58
GPRC5B 0.73 0.75
TPCN1 0.73 0.71
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MED19 -0.52 -0.63
NKIRAS2 -0.50 -0.53
NR2C2AP -0.49 -0.61
LSM7 -0.49 -0.68
DUSP12 -0.49 -0.57
PODXL2 -0.49 -0.54
ZNF821 -0.48 -0.54
TCTEX1D2 -0.48 -0.63
POLB -0.48 -0.60
CCDC28B -0.48 -0.66

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004872 receptor activity TAS 1621094
GO:0005509 calcium ion binding IEA -
GO:0005515 protein binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007411 axon guidance TAS axon (GO term level: 13) 1621094
GO:0007155 cell adhesion IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IDA 18029348
GO:0005730 nucleolus IDA 18029348
GO:0005737 cytoplasm IDA 18029348
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -
GO:0005887 integral to plasma membrane TAS 1621094

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG CELL ADHESION MOLECULES CAMS 134 93 All SZGR 2.0 genes in this pathway
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN 391 222 All SZGR 2.0 genes in this pathway
CORRE MULTIPLE MYELOMA UP 74 45 All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 TARGETS UP 17 11 All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS DN 232 139 All SZGR 2.0 genes in this pathway
SENESE HDAC2 TARGETS DN 133 77 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN 284 156 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
CHEBOTAEV GR TARGETS DN 120 73 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024 594 All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER B 48 22 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP 195 138 All SZGR 2.0 genes in this pathway
LEE TARGETS OF PTCH1 AND SUFU DN 83 69 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL 254 164 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP 487 303 All SZGR 2.0 genes in this pathway
NIELSEN SCHWANNOMA UP 18 16 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 307 185 All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER HCP WITH H3K27ME3 97 72 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS UP 170 107 All SZGR 2.0 genes in this pathway
CAMPS COLON CANCER COPY NUMBER DN 74 34 All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D DN 270 181 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K9ME3 UP 141 75 All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G1 UP 113 70 All SZGR 2.0 genes in this pathway
国外RB1增长目标 243 155 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN 448 282 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-129-5p 1479 1485 1A hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
miR-137 2432 2438 1A hsa-miR-137 UAUUGCUUAAGAAUACGCGUAG
miR-140 1116 1122 1A hsa-miR-140brain AGUGGUUUUACCCUAUGGUAG
miR-183 683 689 1A hsa-miR-183 UAUGGCACUGGUAGAAUUCACUG
miR-214 249 255 m8 hsa-miR-214brain ACAGCAGGCACAGACAGGCAG
miR-218 263 269 m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
miR-23 1497 1504 1A,m8 hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-30-5p 1575 1582 1A,m8 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrain UGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZ UGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZ UGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5p UGUAAACAUCCUUGACUGGA
miR-323 1497 1503 1A hsa-miR-323brain GCACAUUACACGGUCGACCUCU
miR-330 771 777 m8 hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA
miR-410 2238 2244 m8 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-488 547 553 m8 hsa-miR-488 CCCAGAUAAUGGCACUCUCAA
miR-493-5p 1716 1722 m8 hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU
miR-495 2235 2241 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
miR-496 448 454 1A hsa-miR-496 AUUACAUGGCCAAUCUC
miR-542-3p 1525 1531 1A hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
miR-543 1447 1453 m8 hsa-miR-543 AAACAUUCGCGGUGCACUUCU