Gene Page:PPT2

Summary?
GeneID 9374
Symbol PPT2
Synonyms C6orf8|G14|PPT-2
Description palmitoyl-protein thioesterase 2
Reference MIM:603298|HGNC:HGNC:9326|运用:ENSG00000221988|HPRD:04486|Vega:OTTHUMG00000031257
Gene type protein-coding
Map location 6p21.3
Pascal p-value 1E-12
Sherlock p-value 0.853
Fetal beta -0.253
DMG 2 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
DMG:Montano_2016 Genome-wide DNA methylation analysis This dataset includes 172 replicated associations between CpGs with schizophrenia. 2
GSMA_I Genome scan meta-analysis Psr: 0.033

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg06902929 6 32123258 PPT2 1.27E-4 -0.004 0.134 DMG:Montano_2016
cg09672152 6 32122102 PPT2 1.15E-8 -0.015 4.8E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
OXR1 0.93 0.89
ARHGAP26 0.93 0.85
SLC4A10 0.93 0.88
EFR3A 0.93 0.84
NCOA7 0.92 0.87
HTR2A 0.92 0.85
SYNJ1 0.91 0.88
GLS 0.91 0.86
ITPR1 0.91 0.81
ARFGEF2 0.91 0.84
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
BCL7C -0.48 -0.61
AC006276.2 -0.44 -0.44
TBC1D10A -0.44 -0.37
FADS2 -0.41 -0.28
EFEMP2 -0.40 -0.40
RPLP1 -0.40 -0.44
NME4 -0.40 -0.52
HEBP2 -0.39 -0.52
SLC38A5 -0.39 -0.45
RPL23A -0.39 -0.42

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0016787 hydrolase activity IEA -
GO:0008474 palmitoyl-(protein) hydrolase activity NAS 10417332
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006464 蛋白质改性过程 NAS 9341199
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005764 lysosome NAS 9341199

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG LYSOSOME 121 83 All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS UP 137 94 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
BOGNI TREATMENT RELATED MYELOID LEUKEMIA DN 33 19 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 DN 242 165 All SZGR 2.0 genes in this pathway
MISSIAGLIA REGULATED BY METHYLATION UP 126 78 All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER 747 453 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769 437 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037 673 All SZGR 2.0 genes in this pathway
MANTOVANI VIRAL GPCR SIGNALING DN 49 37 All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS 775 494 All SZGR 2.0 genes in this pathway
MAHAJAN RESPONSE TO IL1A DN 76 57 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR UP 180 125 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
LIU VAV3 PROSTATE CARCINOGENESIS DN 17 14 All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED 351 238 All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC 1103 714 All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 4 UP 112 64 All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 6 UP 140 81 All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN 157 106 All SZGR 2.0 genes in this pathway
LINSLEY MIR16 TARGETS 206 127 All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824 528 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-141/200a 541 547 m8 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
hsa-miR-200a UAACACUGUCUGGUAACGAUGU
hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
hsa-miR-200a UAACACUGUCUGGUAACGAUGU
miR-143 574 580 1A hsa-miR-143brain UGAGAUGAAGCACUGUAGCUCA
miR-326 35 41 1A hsa-miR-326 CCUCUGGGCCCUUCCUCCAG