SZGR2 - Beplay体育中心

Summary?

GeneID	9448
Symbol	MAP4K4
Synonyms	FLH21957\|HEL-S-31\|HGK\|MEKKK4\|NIK
Description	mitogen-activated protein kinase kinase kinase kinase 4
Reference	MIM:604666\|HGNC:HGNC:6866\|Ensembl:ENSG00000071054\|HPRD:05235\|Vega:OTTHUMG00000155394
Gene type	protein-coding
Map location	2q11.2-q12
Pascal p-value	0.551
Sherlock p-value	0.127
Fetal beta	1.369
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Ascano FMRP targets

Gene in Data Sources

基因集名称	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
DNM:Guipponi_2014	Whole Exome Sequencing analysis	49 DNMs were identified by comparing the exome of 53 individuals with sporadic SCZ and of their non-affected parents
GSMA_I	Genome scan meta-analysis	Psr: 0.0004

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
MAP4K4			C	T	NM_001242559	p.R599X	nonsense	NA	NA	Schizophrenia	DNM:Guipponi_2014

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg15738916	2	102314495	MAP4K4		-0.022	0.58	DMG:Nishioka_2013

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs758167	chr12	1915558	MAP4K4	9448	0.11	trans
rs12876724	chr13	67078988	MAP4K4	9448	0.07	trans
rs6632306	chrX	35590460	MAP4K4	9448	0.1	trans
rs1935404	chrX	35605181	MAP4K4	9448	0.13	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CLTCL1	0.73	0.71
KIAA0564	0.72	0.79
RCBTB1	0.72	0.80
EIF2AK4	0.72	0.83
CLCN5	0.72	0.74
GLG1	0.72	0.86
MAP3K9	0.71	0.80
KIF21A	0.71	0.82
KIAA1644	0.71	0.71
LARP1	0.71	0.80

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.51	-0.63
CXCL14	-0.51	-0.59
AF347015.31	-0.51	-0.60
IFI27	-0.50	-0.61
MYL3	-0.50	-0.59
HIGD1B	-0.49	-0.59
VAMP5	-0.49	-0.58
FXYD1	-0.48	-0.57
MT-CO2	-0.48	-0.58
C1orf54	-0.48	-0.63

Section III. Gene Ontology annotation

Molecular function	去的术语	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005083	small GTPase regulator activity	IEA		-
GO:0005524	ATP binding	IDA		9890973
GO:0005524	ATP binding	IEA		-
GO:0004674	protein serine/threonine kinase activity	IDA		9890973
GO:0004674	protein serine/threonine kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
Biological process	去的术语	Evidence	Neuro keywords	PubMed ID
GO:0006468	protein amino acid phosphorylation	IDA		9890973
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0007243	protein kinase cascade	IDA		9890973
GO:0006950	response to stress	IDA		9890973
Cellular component	去的术语	Evidence	Neuro keywords	PubMed ID
GO:0005575	cellular_component	ND		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ATL1	AD-FSP \| FSP1 \| GBP3 \| SPG3 \| SPG3A \| atlastin1	atlastin GTPase 1	hGBP3 interacts with HGK.	BIND	12387898
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	Protein-peptide	BioGRID	14578343
CASP8	ALPS2B \| CAP4 \| FLICE \| FLJ17672 \| MACH \| MCH5 \| MGC78473	caspase 8, apoptosis-related cysteine peptidase	-	HPRD	11002417
DOK1	MGC117395 \| MGC138860 \| P62DOK	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	-	HPRD	10669731
GBP3	DKFZp686E0974 \| DKFZp686L15228 \| FLJ10961	guanylate binding protein 3	-	HPRD,BioGRID	12387898
ITGB1	CD29 \| FNRB \| GPIIA \| MDF2 \| MSK12 \| VLA-BETA \| VLAB	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	-	HPRD,BioGRID	11967148
MAP3K1	MAPKKK1 \| MEKK \| MEKK1	mitogen-activated protein kinase kinase kinase 1	Affinity Capture-Western	BioGRID	9135144
MAP3K7	TAK1 \| TGF1a	mitogen-activated protein kinase kinase kinase 7	-	HPRD,BioGRID	10807933
NCK1	MGC12668 \| NCK \| NCKalpha	NCK adaptor protein 1	-	HPRD,BioGRID	9135144
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21蛋白激活剂(GTPase激活prote来in) 1	-	HPRD,BioGRID	10669731
SLC9A1	APNH \| FLJ42224 \| NHE1	solute carrier family 9 (sodium/hydrogen exchanger), member 1	-	HPRD	11369779

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
BIOCARTA MAPK PATHWAY	87	68	All SZGR 2.0 genes in this pathway
PID EPHB FWD PATHWAY	40	38	All SZGR 2.0 genes in this pathway
PID TNF PATHWAY	46	33	All SZGR 2.0 genes in this pathway
PID神经酰胺通路	48	37	All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY	137	94	All SZGR 2.0 genes in this pathway
HOLLMANN APOPTOSIS VIA CD40 UP	201	125	All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP	351	230	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE DN	244	147	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
AKL HTLV1 INFECTION UP	27	16	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 2HR DN	88	53	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR UP	557	331	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP	177	113	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP	293	179	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP	443	294	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 5	147	89	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE UP	134	93	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM2	153	102	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
LIAO METASTASIS	539	324	All SZGR 2.0 genes in this pathway
BYSTROEM CORRELATED WITH IL5 UP	51	30	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 DN	163	115	All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR	293	193	All SZGR 2.0 genes in this pathway
ULE SPLICING VIA NOVA2	43	38	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 6	189	112	All SZGR 2.0 genes in this pathway
DURCHDEWALD SKIN CARCINOGENESIS DN	264	168	All SZGR 2.0 genes in this pathway
LI CYTIDINE ANALOGS CYCTOTOXICITY	15	8	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP	393	244	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS DN	12	9	All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS	245	148	All SZGR 2.0 genes in this pathway
CLAUS PGR POSITIVE MENINGIOMA DN	12	10	All SZGR 2.0 genes in this pathway
LEE METASTASIS AND ALTERNATIVE SPLICING UP	74	51	All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS DN	145	93	All SZGR 2.0 genes in this pathway
GU PDEF TARGETS UP	71	49	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 UP	338	225	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF DN	235	144	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN	245	150	All SZGR 2.0 genes in this pathway
VANASSE BCL2 TARGETS DN	74	50	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN	457	302	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 2	29	14	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G1 UP	113	70	All SZGR 2.0 genes in this pathway
GYORFFY DOXORUBICIN RESISTANCE	56	34	All SZGR 2.0 genes in this pathway
FOURNIER ACINAR DEVELOPMENT LATE 2	277	172	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP	207	143	All SZGR 2.0 genes in this pathway
WINNEPENNINCKX MELANOMA METASTASIS UP	162	86	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO GONADOTROPHINS DN	87	66	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO FORSKOLIN DN	88	68	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN	321	200	All SZGR 2.0 genes in this pathway
IKEDA MIR30 TARGETS UP	116	87	All SZGR 2.0 genes in this pathway
SERVITJA LIVER HNF1A TARGETS UP	135	96	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE	227	151	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4	227	149	All SZGR 2.0 genes in this pathway
LIM MAMMARY LUMINAL MATURE DN	99	74	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR UP	166	97	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	961	968	1A,m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-130/301	1363	1369	1A	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-134	1289	1295	1A	hsa-miR-134^brain	UGUGACUGGUUGACCAGAGGG
miR-145	69	75	m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-181	1382	1388	1A	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-200bc/429	831	838	1A,m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-203.1	492	498	m8	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-23	565	572	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
				hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-29	254	260	1A	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
				hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-30-5p	3128	3135	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-323	506	513	1A,m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-323	506	513	1A,m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-33	1360	1366	m8	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	1360	1366	m8	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-542-3p	1079	1085	1A	hsa-miR-542-3p	UGUGACAGAUUGAUAACUGAAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.

Gene Page:MAP4K4