Gene Page:EIF2AK3

Summary?
GeneID 9451
Symbol EIF2AK3
Synonyms PEK|PERK|WRS
Description eukaryotic translation initiation factor 2 alpha kinase 3
Reference MIM:604032|HGNC:HGNC:3255|Ensembl:ENSG00000172071|HPRD:04942|Vega:OTTHUMG00000155046
Gene type protein-coding
Map location 2p12
Pascal p-value 0.054
Fetal beta 0.719
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_I Genome scan meta-analysis Psr: 0.0004
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg05085631 2 88927217 EIF2AK3 1.47E-9 -0.013 1.39E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0005524 ATP binding IEA -
GO:0004694 eukaryotic translation initiation factor 2alpha kinase activity IDA 10026192|10677345|11907036
GO:0004694 eukaryotic translation initiation factor 2alpha kinase activity IMP 12086964
GO:0016740 transferase activity IEA -
GO:0042802 identical protein binding IPI 11907036
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0031642 negative regulation of myelination IEA 轴突(术语层面:15) -
GO:0001501 skeletal system development IEA -
GO:0002063 chondrocyte development IEA -
GO:0006986 response to unfolded protein IEA -
GO:0048009 insulin-like growth factor receptor signaling pathway IEA -
GO:0007029 endoplasmic reticulum organization IEA -
GO:0006983 ER overload response IDA 10677345|11907036
GO:0006926 virus-infected cell apoptosis IEA -
GO:0006919 caspase activation IEA -
GO:0019722 calcium-mediated signaling IEA -
GO:0030073 insulin secretion IEA -
GO:0031018 endocrine pancreas development IMP 12086964
GO:0032092 positive regulation of protein binding IEA -
GO:0030968 内质网的蛋白质反应 IDA 10677345|11907036
GO:0032057 negative regulation of translational initiation in response to stress TAS 10677345|12086964
GO:0051260 protein homooligomerization IMP 11907036
GO:0030282 bone mineralization IEA -
GO:0017148 negative regulation of translation TAS 12086964
GO:0046777 protein amino acid autophosphorylation IDA 10026192|11907036
GO:0046777 protein amino acid autophosphorylation IMP 12086964
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005789 endoplasmic reticulum membrane NAS 11907036
GO:0005737 cytoplasm IEA -
GO:0005783 endoplasmic reticulum IC 11907036
GO:0005783 endoplasmic reticulum TAS 12086964
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ALZHEIMERS DISEASE 169 110 All SZGR 2.0 genes in this pathway
BIOCARTA EIF2 PATHWAY 11 8 All SZGR 2.0 genes in this pathway
REACTOME DIABETES PATHWAYS 133 91 All SZGR 2.0 genes in this pathway
REACTOME PERK REGULATED GENE EXPRESSION 29 14 All SZGR 2.0 genes in this pathway
REACTOME UNFOLDED PROTEIN RESPONSE 80 51 All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN 240 171 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN 459 276 All SZGR 2.0 genes in this pathway
MAYBURD RESPONSE TO L663536 UP 29 18 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN 508 354 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION DN 234 147 All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN 394 258 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM2 153 102 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893 528 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882 572 All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR 293 193 All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX UP 83 66 All SZGR 2.0 genes in this pathway
CREIGHTON内分泌席拉PY RESISTANCE 3 720 440 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS 217 138 All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP 439 257 All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING 510 309 All SZGR 2.0 genes in this pathway
PODAR RESPONSE TO ADAPHOSTIN UP 147 98 All SZGR 2.0 genes in this pathway
CUI GLUCOSE DEPRIVATION 60 44 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
HOFFMANN IMMATURE TO MATURE B LYMPHOCYTE UP 43 34 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN 442 275 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN 457 302 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN 668 419 All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS 289 187 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP 682 433 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 AND SATB1 UP 87 52 All SZGR 2.0 genes in this pathway
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF 222 159 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-130/301 478 484 1A hsa-miR-130abrain CAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301 CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrain CAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3p UAGUGCAAUAUUGCUUAUAGGGUUU