Gene Page:PREPL

Summary?
GeneID 9581
Symbol PREPL
Synonyms -
Description prolyl endopeptidase-like
Reference MIM:609557|HGNC:HGNC:30228|Ensembl:ENSG00000138078|HPRD:17189|Vega:OTTHUMG00000152791
Gene type protein-coding
Map location 2p21
Pascal p-value 0.756
Fetal beta -1.378
eGene Cerebellum
Cortex

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg14965979 2 44588995 PREPL;C2orf34 4.42E-7 -0.426 0.006 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
TTYH2 0.94 0.90
ICOSLG 0.94 0.90
ATPGD1 0.94 0.94
ABCA2 0.93 0.74
PCTK3 0.93 0.94
ERBB3 0.93 0.93
LDB3 0.93 0.92
C11orf9 0.92 0.94
FA2H 0.92 0.94
CD22 0.92 0.92
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
RPL12 -0.47 -0.77
ALKBH2 -0.47 -0.76
POLB -0.47 -0.76
NKIRAS2 -0.46 -0.66
MED19 -0.46 -0.74
STMN1 -0.46 -0.73
NR2C2AP -0.46 -0.76
TRNAU1AP -0.45 -0.71
IFT52 -0.45 -0.73
HN1 -0.45 -0.71

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004252 serine-type endopeptidase activity IEA glutamate (GO term level: 7) -
GO:0008233 peptidase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006508 proteolysis IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
ONKEN UVEAL MELANOMA DN 526 357 All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP 423 283 All SZGR 2.0 genes in this pathway
WIKMAN ASBESTOS LUNG CANCER UP 17 11 All SZGR 2.0 genes in this pathway
BIDUS METASTASIS UP 214 134 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP DN 199 124 All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 5 147 89 All SZGR 2.0 genes in this pathway
MATTIOLI MGUS VS MULTIPLE MYELOMA 16 11 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424 268 All SZGR 2.0 genes in this pathway
LEE TARGETS OF PTCH1 AND SUFU DN 83 69 All SZGR 2.0 genes in this pathway
JAIN NFKB SIGNALING 75 44 All SZGR 2.0 genes in this pathway
YAGI AML SURVIVAL 129 87 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434 302 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP 973 570 All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP 548 370 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-182 2067 2074 1A,m8 hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-31 2102 2109 1A,m8 hsa-miR-31 AGGCAAGAUGCUGGCAUAGCUG
miR-96 2068 2074 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC