Gene Page:PDE4DIP

Summary?
GeneID 9659
Symbol PDE4DIP
Synonyms CMYA2|MMGL
Description phosphodiesterase 4D interacting protein
Reference MIM:608117|HGNC:HGNC:15580|Ensembl:ENSG00000178104|HPRD:10482|Vega:OTTHUMG00000013846
Gene type protein-coding
Map location 1q12
Fetal beta -1.838
Support CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CNV:YES Copy number variation studies Manual curation
DNM:Fromer_2014 Whole Exome Sequencing analysis This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.0235
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00814
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
PDE4DIP chr1 144931128 A C NM_001002811
NM_001002812
NM_001198832
NM_001198834
NM_014644		 p.194I>S
.
.
.
.		 missense
intronic
intronic
intronic
intronic		 Schizophrenia DNM:Fromer_2014
PDE4DIP chr1 144931615 G A NM_001002811
NM_001002812
NM_001198832
NM_001198834
NM_014644		 .
.
.
.
.		 silent
intronic
intronic
intronic
intronic		 Schizophrenia DNM:Xu_2012


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003779 actin binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
去:0007010 cytoskeleton organization IEA -
GO:0030036 actin cytoskeleton organization IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005794 Golgi apparatus IEA -
GO:0005813 centrosome IEA -
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -
GO:0015629 actin cytoskeleton IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PARENT MTOR SIGNALING UP 567 375 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP 783 507 All SZGR 2.0 genes in this pathway
TURASHVILI BREAST NORMAL DUCTAL VS LOBULAR UP 68 40 All SZGR 2.0 genes in this pathway
LIU VMYB TARGETS UP 127 78 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP 85 54 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D DN 142 90 All SZGR 2.0 genes in this pathway
AKL HTLV1 INFECTION DN 68 41 All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP 457 269 All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP 238 144 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN 459 276 All SZGR 2.0 genes in this pathway
BIDUS METASTASIS DN 161 93 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP 612 367 All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP 207 128 All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355 243 All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP 390 236 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN 428 306 All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN 411 249 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 UP 140 85 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882 572 All SZGR 2.0 genes in this pathway
YAGI AML SURVIVAL 129 87 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM 302 191 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN 371 218 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN 830 547 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN 298 200 All SZGR 2.0 genes in this pathway
LU AGING BRAIN UP 262 186 All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434 302 All SZGR 2.0 genes in this pathway
MCDOWELL ACUTE LUNG INJURY DN 48 33 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA RADIATION 81 59 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP 226 164 All SZGR 2.0 genes in this pathway
HELLER SILENCED BY METHYLATION UP 282 183 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS UP 317 208 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602 364 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN 353 226 All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469 239 All SZGR 2.0 genes in this pathway
MCCABE HOXC6 TARGETS UP 10 8 All SZGR 2.0 genes in this pathway
MCCABE HOXC6 TARGETS CANCER UP 31 23 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 DN 228 114 All SZGR 2.0 genes in this pathway
阿塞维多甲基化在肝脏CER DN 940 425 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE UP 97 61 All SZGR 2.0 genes in this pathway
BASSO HAIRY CELL LEUKEMIA DN 80 66 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP 260 174 All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP 323 240 All SZGR 2.0 genes in this pathway
发情ELLA RESPONSE TO CSF2RB AND IL4 UP 338 225 All SZGR 2.0 genes in this pathway
发情ELLA RESPONSE TO HGF UP 418 282 All SZGR 2.0 genes in this pathway
发情ELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP 408 276 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED 536 296 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
NAKAYAMA SOFT TISSUE TUMORS PCA1 UP 76 46 All SZGR 2.0 genes in this pathway
MARTENS受PML RARA融合 456 287 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN 841 431 All SZGR 2.0 genes in this pathway
GREGORY SYNTHETIC LETHAL WITH IMATINIB 145 83 All SZGR 2.0 genes in this pathway
JUBAN TARGETS OF SPI1 AND FLI1 DN 92 60 All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR UP 199 143 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-183 1615 1621 1A hsa-miR-183 UAUGGCACUGGUAGAAUUCACUG