Gene Page:SETD1A

Summary?
GeneID 9739
Symbol SETD1A
Synonyms KMT2F|Set1|Set1A
Description SET domain containing 1A
Reference MIM:611052|HGNC:HGNC:29010|Ensembl:ENSG00000099381|HPRD:13795|Vega:OTTHUMG00000150474
Gene type protein-coding
Map location 16p11.2
Pascal p-value 0.515
Sherlock p-value 0.257
Fetal beta -0.273
DMG 1 (# studies)
eGene Myers' cis & trans
元
Support Chromatin Remodeling Genes

Gene in Data Sources
Gene set name Method of gene set Description Info
DMG:vanEijk_2014 Genome-wide DNA methylation analysis This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). 1
DNM:Guipponi_2014 Whole Exome Sequencing analysis 49 DNMs were identified by comparing the exome of 53 individuals with sporadic SCZ and of their non-affected parents
PMID:cooccur High-throughput literature-search 系统搜索PubMed的genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.01775
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
SETD1A chr16 30970148 G T NM_014712 . silent Schizophrenia DNM:Xu_2012
SETD1A NM_014712 c.4582delAG.- splice NA NA Schizophrenia DNM:Guipponi_2014

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg26233914 16 31366536 SETD1A 0.002 3.945 DMG:vanEijk_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs4141780 chr20 40297792 SETD1A 9739 0.14 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
POM121C 0.97 0.97
SSH1 0.93 0.94
UBN1 0.92 0.94
GBF1 0.92 0.94
TBC1D24 0.92 0.94
RPAP1 0.92 0.94
HCFC1 0.92 0.94
PCNXL3 0.92 0.90
ZFYVE20 0.92 0.92
SEC16A 0.91 0.92
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.31 -0.69 -0.73
AF347015.21 -0.68 -0.81
MT-CO2 -0.68 -0.73
HIGD1B -0.66 -0.73
C1orf54 -0.66 -0.83
FXYD1 -0.65 -0.69
GNG11 -0.64 -0.75
MT-CYB -0.64 -0.67
AF347015.8 -0.64 -0.70
AF347015.33 -0.64 -0.66

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0003723 RNA binding IEA -
GO:0005515 protein binding 新闻学会 12670868
GO:0016740 transferase activity IEA -
GO:0008168 methyltransferase activity IEA -
GO:0018024 histone-lysine N-methyltransferase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0006350 transcription IEA -
GO:0016568 chromatin modification IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0016607 nuclear speck IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG LYSINE DEGRADATION 44 29 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN 335 193 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP 151 100 All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT REJECTED VS OK DN 51 35 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882 572 All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS DN 234 137 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN 668 419 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-142-5p 626 632 m8 hsa-miR-142-5p CAUAAAGUAGAAAGCACUAC
miR-485-5p 146 152 1A hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC