Gene Page:SNPH
Summary?
GeneID | 9751 |
Symbol | SNPH |
Synonyms | - |
Description | syntaphilin |
Reference | MIM:604942|HGNC:HGNC:15931|Ensembl:ENSG00000101298|HPRD:16081|Vega:OTTHUMG00000031662 |
Gene type | protein-coding |
Map location | 20p13 |
Pascal p-value | 0.008 |
Sherlock p-value | 0.05 |
Fetal beta | -1.807 |
eGene | Cerebellar Hemisphere |
Support | CANABINOID DOPAMINE SEROTONIN CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/SNPH_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AGPAT3 | 0.92 | 0.93 |
NFE2L1 | 0.91 | 0.92 |
SIDT2 | 0.89 | 0.89 |
SPATA2 | 0.89 | 0.89 |
TBC1D9B | 0.89 | 0.90 |
AP006216.1 | 0.88 | 0.93 |
TOM1L2 | 0.88 | 0.88 |
ATG9A | 0.88 | 0.88 |
ZBTB4 | 0.87 | 0.91 |
AMIGO1 | 0.87 | 0.87 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C8orf59 | -0.56 | -0.54 |
GNG11 | -0.55 | -0.51 |
AL050337.1 | -0.54 | -0.53 |
ST20 | -0.54 | -0.57 |
PFDN5 | -0.54 | -0.52 |
SYCP3 | -0.53 | -0.51 |
C1orf54 | -0.53 | -0.45 |
RPL31 | -0.52 | -0.57 |
RPL35 | -0.51 | -0.56 |
C1orf61 | -0.51 | -0.46 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0017075 | syntaxin-1 binding | NAS | 10707983 | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0007269 | neurotransmitter secretion | NAS | neuron, axon, Synap, serotonin, Neurotransmitter, dopamine (GO term level: 8) | 10707983 |
GO:0016081 | synaptic vesicle docking during exocytosis | NAS | Synap (GO term level: 10) | 10707983 |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0019717 | synaptosome | IEA | Synap, Brain (GO term level: 7) | - |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER ERBB2 UP | 147 | 83 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS DN | 116 | 74 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-130/301 | 1022 | 1029 | 1A,m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-148/152 | 1637 | 1643 | m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-19 | 1021 | 1027 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-331 | 3152 | 3158 | 1A | hsa-miR-331brain | GCCCCUGGGCCUAUCCUAGAA |
miR-346 | 3237 | 3243 | 1A | hsa-miR-346brain | UGUCUGCCCGCAUGCCUGCCUCU |
miR-485-3p | 1970 | 1977 | 1A,m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.