Gene Page:KIAA0513
Summary?
GeneID | 9764 |
Symbol | KIAA0513 |
Synonyms | - |
Description | KIAA0513 |
Reference | MIM:611675|HGNC:HGNC:29058|Ensembl:ENSG00000135709|HPRD:17192|Vega:OTTHUMG00000176597 |
Gene type | protein-coding |
Map location | 16q24.1 |
Pascal p-value | 0.002 |
Sherlock p-value | 0.945 |
Fetal beta | -1.874 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/KIAA0513_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FBXO28 | 0.94 | 0.95 |
UBE2K | 0.93 | 0.95 |
SRPK2 | 0.92 | 0.94 |
UCHL5 | 0.92 | 0.93 |
APPL1 | 0.92 | 0.94 |
SLC25A46 | 0.91 | 0.93 |
ACTR2 | 0.91 | 0.93 |
RAB14 | 0.91 | 0.94 |
PJA2 | 0.91 | 0.94 |
API5L1 | 0.91 | 0.94 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FXYD1 | -0.68 | -0.71 |
HIGD1B | -0.66 | -0.70 |
GSDMD | -0.65 | -0.70 |
CST3 | -0.64 | -0.70 |
RAB34 | -0.64 | -0.72 |
TLCD1 | -0.64 | -0.68 |
S100A16 | -0.63 | -0.68 |
MT-CO2 | -0.63 | -0.67 |
METRN | -0.63 | -0.70 |
HSD17B14 | -0.62 | -0.67 |
Section III. Gene Ontology annotation
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP | 182 | 110 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
TAVOR CEBPA TARGETS UP | 48 | 36 | All SZGR 2.0 genes in this pathway |
DURCHDEWALD SKIN CARCINOGENESIS DN | 264 | 168 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
AMBROSINI FLAVOPIRIDOL TREATMENT TP53 | 109 | 63 | All SZGR 2.0 genes in this pathway |
CHUNG BLISTER CYTOTOXICITY DN | 44 | 29 | All SZGR 2.0 genes in this pathway |
GRATIAS RETINOBLASTOMA 16Q24 | 17 | 15 | All SZGR 2.0 genes in this pathway |
ZHAN V1 LATE DIFFERENTIATION GENES UP | 32 | 25 | All SZGR 2.0 genes in this pathway |
SENGUPTA EBNA1 ANTICORRELATED | 173 | 85 | All SZGR 2.0 genes in this pathway |
金所有障碍少突细胞数量ORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 6HR DN | 91 | 56 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS VIA AKT1 DN | 82 | 51 | All SZGR 2.0 genes in this pathway |
IVANOVSKA MIR106B TARGETS | 90 | 56 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-17-5p/20/93.mr/106/519.d | 5175 | 5182 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-326 | 106 | 112 | m8 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.