Gene Page:RAPGEF5
Summary?
GeneID | 9771 |
Symbol | RAPGEF5 |
Synonyms | GFR|MR-GEF|REPAC |
Description | Rap guanine nucleotide exchange factor 5 |
Reference | MIM:609527|HGNC:HGNC:16862|Ensembl:ENSG00000136237|HPRD:15208|Vega:OTTHUMG00000152525 |
Gene type | protein-coding |
Map location | 7p15.3 |
Pascal p-value | 0.035 |
Sherlock p-value | 0.694 |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | 我nfo |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/RAPGEF5_DE_GTEx.png)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
BTBD9 | 0.88 | 0.89 |
TRAPPC10 | 0.86 | 0.86 |
ABR | 0.86 | 0.87 |
ATXN1L | 0.86 | 0.86 |
SYT11 | 0.86 | 0.86 |
RGL1 | 0.86 | 0.86 |
HIPK1 | 0.85 | 0.87 |
RAPGEF2 | 0.85 | 0.86 |
LRP11 | 0.85 | 0.84 |
MTMR12 | 0.85 | 0.86 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.57 | -0.48 |
C1orf54 | -0.55 | -0.54 |
GNG11 | -0.54 | -0.49 |
我L32 | -0.53 | -0.51 |
SYCP3 | -0.53 | -0.53 |
AL050337.1 | -0.51 | -0.49 |
C1orf61 | -0.50 | -0.52 |
AC098691.2 | -0.50 | -0.48 |
APOC1 | -0.49 | -0.42 |
VAMP5 | -0.49 | -0.38 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005085 | guanyl-nucleotide交换因素活动 | 我EA | - | |
GO:0017034 | Rap guanyl-nucleotide exchange factor activity | 我DA | 10486569 | |
GO:0030742 | GTP-dependent protein binding | 我PI | 10934204 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | NAS | neurite (GO term level: 5) | 10486569 |
GO:0007264 | small GTPase mediated signal transduction | 我EA | - | |
GO:0051056 | regulation of small GTPase mediated signal transduction | 我EA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | 我EA | - | |
GO:0005634 | nucleus | 我DA | 10486569 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | 我nfo |
---|---|---|---|
SCHUETZ BREAST CANCER DUCTAL INVASIVE DN | 84 | 53 | All SZGR 2.0 genes in this pathway |
HORIUCHI WTAP TARGETS UP | 306 | 188 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS GREY DN | 74 | 44 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D DN | 31 | 19 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
KIM MYC AMPLIFICATION TARGETS UP | 201 | 127 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS UP | 292 | 168 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
BASSO CD40 SIGNALING DN | 68 | 44 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP | 131 | 87 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 VS CD2 DN | 52 | 35 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
我VANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P3 | 160 | 103 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL DN | 216 | 143 | All SZGR 2.0 genes in this pathway |
JIANG TIP30 TARGETS UP | 46 | 28 | All SZGR 2.0 genes in this pathway |
LEE EARLY T LYMPHOCYTE UP | 107 | 59 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 4 | 110 | 66 | All SZGR 2.0 genes in this pathway |
YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 3554 | 3560 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-125/351 | 3790 | 3797 | 1A,m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-137 | 3997 | 4004 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG | ||||
miR-144 | 3554 | 3560 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-182 | 3527 | 3534 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-196 | 3779 | 3785 | 1A | hsa-miR-196a | UAGGUAGUUUCAUGUUGUUGG |
hsa-miR-196b | UAGGUAGUUUCCUGUUGUUGG | ||||
miR-218 | 1871 | 1877 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-219 | 621 | 627 | 1A | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
miR-378 | 149 | 155 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-496 | 3983 | 3989 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-96 | 3528 | 3534 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.