Gene Page:KIAA0141

Summary?
GeneID 9812
Symbol KIAA0141
Synonyms DELE
Description KIAA0141
Reference MIM:615741|HGNC:HGNC:28969|Ensembl:ENSG00000081791|HPRD:13780|Vega:OTTHUMG00000129662
Gene type protein-coding
Map location 5q31.3
Pascal p-value 0.03
Sherlock p-value 1.327E-5
Fetal beta 0.335
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GSMA_I Genome scan meta-analysis Psr: 0.0032

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16829545 chr2 151977407 KIAA0141 9812 0 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
DOC2A 0.79 0.84
CCKBR 0.78 0.83
SULT4A1 0.77 0.83
RND1 0.76 0.84
NRSN2 0.76 0.78
GFRA2 0.75 0.82
CHRM1 0.75 0.75
CRY2 0.74 0.77
ANKRD56 0.74 0.81
ANKRD34A 0.74 0.78
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
NSBP1 -0.44 -0.53
RAB13 -0.44 -0.55
PECI -0.43 -0.44
AP002478.3 -0.41 -0.45
AF347015.18 -0.41 -0.39
C11orf67 -0.40 -0.46
C19orf18 -0.40 -0.45
AL139819.3 -0.40 -0.39
AF347015.21 -0.39 -0.31
GPR125 -0.38 -0.32

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005488 binding IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005739 mitochondrion IDA 10942595

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PARENT MTOR SIGNALING UP 567 375 All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN 634 384 All SZGR 2.0 genes in this pathway
PUIFFE INVASION INHIBITED BY ASCITES UP 82 51 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP 372 227 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
GALE APL WITH FLT3 MUTATED UP 56 35 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA HP UP 49 26 All SZGR 2.0 genes in this pathway
HOEGERKORP CD44 TARGETS TEMPORAL DN 25 16 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD DN 150 93 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN 298 200 All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC DN 228 146 All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 UP 167 99 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway
ZWANG EGF INTERVAL DN 214 124 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-146 831 837 1A hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU
hsa-miR-146bbrain UGAGAACUGAAUUCCAUAGGCU