Gene Page:TBC1D4
Summary?
| GeneID | 9882 |
| Symbol | TBC1D4 |
| Synonyms | AS160|NIDDM5 |
| Description | TBC1 domain family member 4 |
| Reference | MIM:612465|HGNC:HGNC:19165|Ensembl:ENSG00000136111|HPRD:18164|Vega:OTTHUMG00000017088 |
| Gene type | protein-coding |
| Map location | 13q22.2 |
| Pascal p-value | 0.285 |
| Sherlock p-value | 0.444 |
| Fetal beta | -0.658 |
| DMG | 1 (# studies) |
| eGene | Cerebellum Cortex Myers' cis & trans |
| Support | Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
Section I. Genetics and epigenetics annotation
DNM table
DNM table| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| TBC1D4 | chr13 | 76055883 | A | G | NM_014832 | . | silent | Schizophrenia | DNM:Fromer_2014 |
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg17878506 | 13 | 76056784 | TBC1D4 | 2.037E-4 | -0.364 | 0.035 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs2256500 | chr1 | 17890573 | TBC1D4 | 9882 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MTMR6 | 0.89 | 0.89 |
| ARL1 | 0.89 | 0.90 |
| TSNAX | 0.88 | 0.89 |
| IMPA1 | 0.88 | 0.90 |
| SPTLC1 | 0.86 | 0.87 |
| C6orf211 | 0.86 | 0.89 |
| DNAJB9 | 0.86 | 0.89 |
| PPP3R1 | 0.86 | 0.89 |
| EFHA2 | 0.85 | 0.90 |
| ARL8B | 0.85 | 0.87 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AL022328.1 | -0.51 | -0.57 |
| ZNF814 | -0.46 | -0.52 |
| AC006028.3 | -0.46 | -0.50 |
| C16orf79 | -0.45 | -0.49 |
| AC010300.1 | -0.44 | -0.47 |
| DMPK | -0.44 | -0.43 |
| NPIP | -0.43 | -0.43 |
| IL3RA | -0.43 | -0.57 |
| WDR86 | -0.43 | -0.42 |
| SMTN | -0.42 | -0.45 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| C12orf35 | FLJ10652 | FLJ20696 | chromosome 12 open reading frame 35 | - | HPRD | 12421765 |
| C3orf63 | DKFZp686C2456 | KIAA1105 | RAP140 | se89-1 | chromosome 3 open reading frame 63 | - | HPRD | 12421765 |
| CDK5RAP2 | C48 | Cep215 | DKFZp686B1070 | DKFZp686D1070 | KIAA1633 | MCPH3 | CDK5 regulatory subunit associated protein 2 | - | HPRD | 12421765 |
| DNPEP | ASPEP | DAP | aspartyl aminopeptidase | Affinity Capture-MS | BioGRID | 17353931 |
| EP400 | CAGH32 | DKFZP434I225 | FLJ42018 | FLJ45115 | P400 | TNRC12 | E1A binding protein p400 | - | HPRD | 12421765 |
| KIAA0556 | - | KIAA0556 | - | HPRD | 12421765 |
| NAV1 | DKFZp781D0314 | FLJ12560 | FLJ14203 | KIAA1151 | MGC14961 | POMFIL3 | steerin-1 | neuron navigator 1 | - | HPRD | 12421765 |
| NFAT5 | KIAA0827 | NF-AT5 | NFATL1 | NFATZ | OREBP | TONEBP | nuclear factor of activated T-cells 5, tonicity-responsive | - | HPRD | 12421765 |
| RBM12 | HRIHFB2091 | KIAA0765 | SWAN | RNA binding motif protein 12 | - | HPRD | 12421765 |
| TOPBP1 | TOP2BP1 | topoisomerase (DNA) II binding protein 1 | - | HPRD | 12421765 |
| ZMIZ1 | FLJ13541 | KIAA1224 | MIZ | RAI17 | Zimp10 | hZIMP10 | zinc finger, MIZ-type containing 1 | - | HPRD | 12421765 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID INSULIN GLUCOSE PATHWAY | 26 | 24 | All SZGR 2.0 genes in this pathway |
| PID PI3KCI AKT PATHWAY | 35 | 30 | All SZGR 2.0 genes in this pathway |
| LIU PROSTATE CANCER UP | 96 | 57 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
| DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
| RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 1 UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
| RODRIGUES NTN1 AND DCC TARGETS | 35 | 25 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
| KIM GERMINAL CENTER T HELPER UP | 66 | 42 | All SZGR 2.0 genes in this pathway |
| WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
| KAAB HEART ATRIUM VS VENTRICLE DN | 261 | 183 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
| 阿塞维多甲基化在肝脏CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN | 245 | 150 | All SZGR 2.0 genes in this pathway |
| LEE EARLY T LYMPHOCYTE DN | 57 | 36 | All SZGR 2.0 genes in this pathway |
| JISON SICKLE CELL DISEASE DN | 181 | 97 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-138 | 761 | 767 | 1A | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
| miR-181 | 431 | 438 | 1A,m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
| hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
| hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
| hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
| miR-23 | 1097 | 1103 | 1A | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
| hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
| miR-26 | 418 | 425 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| miR-433-3p | 307 | 313 | 1A | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
| miR-493-5p | 212 | 218 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-9 | 448 | 454 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- 大脑:exp micrornaressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.