Gene Page:ATXN2

Summary?
GeneID 6311
Symbol ATXN2
Synonyms ASL13|ATX2|SCA2|TNRC13
Description ataxin 2
Reference MIM:601517|HGNC:HGNC:10555|Ensembl:ENSG00000204842|HPRD:03307|Vega:OTTHUMG00000133475
Gene type protein-coding
Map location 12q24.1
Pascal p-value 0.308
Sherlock p-value 0.143
Fetal beta 0.077
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
CV:PheWAS Phenome-wide association studies (PheWAS) 157 SNPs associated with schizophrenia 0
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.02

Section I. Genetics and epigenetics annotation

@CV:PheWAS

SNP ID Chromosome Position Allele P Function Gene Up/Down Distance

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs6128541 chr20 57917688 ATXN2 6311 0.1 trans
rs1964825 chr20 57919515 ATXN2 6311 0.18 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0003723 RNA binding NAS 10814712
GO:0008022 protein C-terminus binding 新闻学会 15663938
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006417 regulation of translation NAS 16835262
GO:0016070 RNA metabolic process NAS 15663938
GO:0008219 cell death IEA -
GO:0034063 stress granule assembly IMP 17392519
GO:0033962 cytoplasmic mRNA processing body assembly IMP 17392519
GO:0050658 RNA transport NAS 10814712
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005794 Golgi apparatus IDA 12812977|17097639
GO:0005802 trans-Golgi network IDA 10814712
GO:0005844 polysome IDA 16835262
GO:0005737 cytoplasm IDA 10814712|17392519
GO:0010494 stress granule IDA 17392519
GO:0048471 perinuclear region of cytoplasm IDA 17097639

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
ENK UV RESPONSE KERATINOCYTE DN 485 334 All SZGR 2.0 genes in this pathway
BERENJENO ROCK SIGNALING NOT VIA RHOA DN 48 34 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN 483 336 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN 514 319 All SZGR 2.0 genes in this pathway
UEDA PERIFERAL CLOCK 169 111 All SZGR 2.0 genes in this pathway
GUO HEX TARGETS UP 81 54 All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION DN 98 67 All SZGR 2.0 genes in this pathway
STEARMAN LUNG CANCER EARLY VS LATE UP 125 89 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN 540 340 All SZGR 2.0 genes in this pathway
SHEDDEN肺CANCER GOOD SURVIVAL A4 196 124 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL SCP2 QTL TRANS 25 13 All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS UP 221 135 All SZGR 2.0 genes in this pathway
GUO TARGETS OF IRS1 AND IRS2 98 67 All SZGR 2.0 genes in this pathway
PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN 106 77 All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF 367 231 All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462 273 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-145 265 272 1A,m8 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCUU
miR-15/16/195/424/497 346 353 1A,m8 hsa-miR-15abrain UAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brain UAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrain UAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZ UAGCAGCACAGAAAUAUUGGC
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497 CAGCAGCACACUGUGGUUUGU
miR-204/211 516 522 1A hsa-miR-204brain UUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
miR-218 64 70 m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
miR-433-3p 302 308 1A hsa-miR-433brain AUCAUGAUGGGCUCCUCGGUGU
miR-503 347 353 1A hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG