Gene Page:DPP4
Summary?
GeneID | 1803 |
Symbol | DPP4 |
Synonyms | ADABP|ADCP2|CD26|DPPIV|TP103 |
Description | dipeptidyl peptidase 4 |
Reference | 米IM:102720|HGNC:HGNC:3009|Ensembl:ENSG00000197635|HPRD:02187|Vega:OTTHUMG00000132056 |
Gene type | protein-coding |
米ap location | 2q24.3 |
帕斯卡假定值 | 2.019E-6 |
Fetal beta | 1.306 |
Gene in Data Sources
Gene set name | 米ethod of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:PGC128 | Genome-wide Association Study | A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | 米apping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
CV:PGC128
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|---|---|---|---|---|---|---|
rs2909457 | chr2 | 162845855 | AG | 4.375E-8 | intergenic | SLC4A10,DPP4 | dist=4069;dist=2900 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/DPP4_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
DMPK | 0.60 | 0.69 |
AC004410.1 | 0.57 | 0.67 |
SLC12A9 | 0.57 | 0.67 |
PRX | 0.56 | 0.66 |
AC006028.3 | 0.56 | 0.63 |
CCDC37 | 0.54 | 0.48 |
ZNF296 | 0.53 | 0.65 |
AMIGO3 | 0.53 | 0.68 |
PCSK4 | 0.53 | 0.58 |
AP006284.2 | 0.53 | 0.53 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
KBTBD3 | -0.43 | -0.58 |
UGP2 | -0.41 | -0.46 |
ATP6V1E1 | -0.40 | -0.40 |
FAM162A | -0.39 | -0.49 |
HIGD1A | -0.39 | -0.49 |
CHN1 | -0.39 | -0.39 |
米DH1 | -0.38 | -0.39 |
C12orf29 | -0.38 | -0.45 |
TMEM70 | -0.38 | -0.41 |
C1orf43 | -0.38 | -0.40 |
Section III. Gene Ontology annotation
米olecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004252 | serine-type endopeptidase activity | IEA | glutamate (GO term level: 7) | - |
GO:0004177 | aminopeptidase activity | IEA | - | |
GO:0005515 | protein binding | 新闻学会 | 7594462|14684150 | |
GO:0008239 | dipeptidyl-peptidase activity | IDA | 14684150 | |
GO:0008233 | peptidase activity | IEA | - | |
GO:0042803 | protein homodimerization activity | 新闻学会 | 14684150 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001666 | response to hypoxia | IDA | 16670267 | |
GO:0006508 | proteolysis | IEA | - | |
GO:0042110 | T细胞激活 | IDA | 7594462 | |
GO:0033632 | regulation of cell-cell adhesion mediated by integrin | IDA | 11772392 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0009986 | cell surface | IDA | 7594462|11772392 | |
GO:0005886 | plasma membrane | IDA | 16670267 | |
GO:0046581 | intercellular canaliculus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOMEINTEGRATION OF ENERGY METABOLISM | 120 | 84 | All SZGR 2.0 genes in this pathway |
REACTOMEREGULATION OF INSULIN SECRETION | 93 | 65 | All SZGR 2.0 genes in this pathway |
REACTOMESYNTHESIS SECRETION AND INACTIVATION OF GIP | 14 | 8 | All SZGR 2.0 genes in this pathway |
REACTOMEINCRETIN SYNTHESIS SECRETION AND INACTIVATION | 22 | 14 | All SZGR 2.0 genes in this pathway |
REACTOMESYNTHESIS SECRETION AND INACTIVATION OF GLP1 | 19 | 12 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
CORRE MULTIPLE MYELOMA UP | 74 | 45 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D DN | 143 | 83 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
CAVARD LIVER CANCER MALIGNANT VS BENIGN | 32 | 19 | All SZGR 2.0 genes in this pathway |
米URATA VIRULENCE OF H PILORI | 24 | 16 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER CIPROFIBRATE DN | 66 | 43 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER ACOX1 DN | 65 | 39 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
LENAOUR DENDRITIC CELL MATURATION UP | 114 | 84 | All SZGR 2.0 genes in this pathway |
TRAYNOR RETT SYNDROM UP | 45 | 33 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE DN | 123 | 76 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
米CDOWELL ACUTE LUNG INJURY DN | 48 | 33 | All SZGR 2.0 genes in this pathway |
HOWLIN CITED1 TARGETS 1 UP | 35 | 25 | All SZGR 2.0 genes in this pathway |
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR UP | 174 | 96 | All SZGR 2.0 genes in this pathway |
ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C CLUSTER UP | 38 | 26 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C UP | 47 | 29 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 1 | 28 | 19 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G56 UP | 12 | 9 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP | 176 | 110 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
FONTAINE FOLLICULAR THYROID ADENOMA DN | 68 | 45 | All SZGR 2.0 genes in this pathway |
FONTAINE PAPILLARY THYROID CARCINOMA UP | 66 | 38 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS DN | 306 | 191 | All SZGR 2.0 genes in this pathway |
LI INDUCED T TO NATURAL KILLER DN | 116 | 83 | All SZGR 2.0 genes in this pathway |
米IYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP | 259 | 159 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
SERVITJA ISLET HNF1A TARGETS DN | 109 | 71 | All SZGR 2.0 genes in this pathway |
SERVITJA LIVER HNF1A TARGETS DN | 157 | 105 | All SZGR 2.0 genes in this pathway |
KOHOUTEK CCNT2 TARGETS | 58 | 35 | All SZGR 2.0 genes in this pathway |
BOSCO ALLERGEN INDUCED TH2 ASSOCIATED MODULE | 151 | 86 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF | 222 | 159 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | 米atch method | |||
miR-140 | 602 | 609 | 1A,m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
miR-148/152 | 585 | 591 | 1A | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-153 | 577 | 583 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-205 | 848 | 854 | 1A | hsa-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
miR-22 | 770 | 776 | m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
miR-29 | 686 | 692 | 1A | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-378 | 564 | 570 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-448 | 576 | 583 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
miR-9 | 625 | 631 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.