Gene Page:DRD2

Summary?
GeneID 1813
Symbol DRD2
Synonyms D2DR|D2R
Description dopamine receptor D2
Reference MIM:126450|HGNC:HGNC:3023|Ensembl:ENSG00000149295|HPRD:00539|Vega:OTTHUMG00000167717
Gene type protein-coding
Map location 11q23
Pascal p-value 1.601E-7
Fetal beta -0.638
eGene Myers' cis & trans
Support GPCR SIGNALLING
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene set Description Info
ADT:Sun_2012 Systematic Investigation of Antipsychotic Drugs and Their Targets A total of 382 drug-target associations involving 43 antipsychotic drugs and 49 target genes.
CV:GWAScat Genome-wide Association Studies This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGC128 Genome-wide Association Study A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association A combined odds ratio method (Sun et al. 2008), association studies 3 Link to SZGene
GSMA_I Genome scan meta-analysis Psr: 0.006
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizotypy,schizophrenias,schizotypal Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 16
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 31

Section I. Genetics and epigenetics annotation

@CV:PGC128

SNP ID Chromosome Position Allele P Function Gene Up/Down Distance
rs2514218 chr11 113392994 TC 4.091E-10 intergenic DRD2,TMPRSS5 dist=46993;dist=165274

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs2190759 chr17 55794698 DRD2 1813 0.08 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

基因表达在发展脉络(BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004952 dopamine receptor activity IEA Neurotransmitter, dopamine (GO term level: 8) -
GO:0001670 dopamine D2 receptor activity IDA dopamine (GO term level: 10) 8301582
GO:0004872 receptor activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0048755 branching morphogenesis of a nerve ISS neuron (GO term level: 6) -
GO:0007416 synaptogenesis ISS Synap (GO term level: 6) -
GO:0007409 axonogenesis ISS neuron, axon, neurite (GO term level: 12) -
GO:0060160 negative regulation of dopamine receptor signaling pathway ISS dopamine (GO term level: 10) -
GO:0060158 dopamine receptor, phospholipase C activating pathway IGI dopamine (GO term level: 10) 17194762
GO:0051586 positive regulation of dopamine uptake ISS dopamine (GO term level: 12) -
GO:0051967 negative regulation of synaptic transmission, glutamatergic ISS neuron, glutamate, Synap, Neurotransmitter (GO term level: 10) -
GO:0007270 nerve-nerve synaptic transmission ISS neuron, Synap (GO term level: 7) -
GO:0048169 regulation of long-term neuronal synaptic plasticity ISS neuron, Synap (GO term level: 10) -
GO:0032228 regulation of synaptic transmission, GABAergic ISS neuron, GABA, Synap, Neurotransmitter (GO term level: 9) -
GO:0021853 cerebral cortex GABAergic interneuron migration ISS neuron, GABA (GO term level: 14) -
GO:0042417 dopamine metabolic process IC Neurotransmitter, dopamine (GO term level: 8) 8301582
GO:0001659 temperature homeostasis ISS -
GO:0002052 positive regulation of neuroblast proliferation ISS -
GO:0002027 regulation of heart rate ISS -
GO:0002028 regulation of sodium ion transport ISS -
GO:0001975 response to amphetamine ISS -
GO:0001976 regulation of systemic arterial blood pressure by neurological process ISS -
GO:0007186 G-protein coupled receptor protein signaling pathway IEA -
GO:0007165 signal transduction IEA -
GO:0008285 negative regulation of cell proliferation ISS -
GO:0008306 associative learning ISS -
GO:0008542 visual learning ISS -
GO:0009416 response to light stimulus ISS -
GO:0007628 adult walking behavior ISS -
GO:0007626 locomotory behavior ISS -
GO:0008104 protein localization ISS -
GO:0007608 sensory perception of smell ISS -
GO:0042493 response to drug ISS -
GO:0021984 adenohypophysis development ISS -
GO:0030432 peristalsis ISS -
GO:0051209 release of sequestered calcium ion into cytosol ISS -
GO:0030814 regulation of cAMP metabolic process IDA 8666994
GO:0030146 diuresis ISS -
GO:0030147 natriuresis ISS -
GO:0032922 circadian regulation of gene expression ISS -
GO:0030384 phosphoinositide metabolic process ISS -
GO:0030336 negative regulation of cell migration ISS -
GO:0043278 response to morphine ISS -
GO:0043266 regulation of potassium ion transport ISS -
GO:0048148 behavioral response to cocaine ISS -
GO:0048149 behavioral response to ethanol ISS -
GO:0050709 negative regulation of protein secretion IDA 16839358
GO:0050482 arachidonic acid secretion IDA 8301582
: 0060124 positive regulation of growth hormone secretion ISS -
GO:0045776 negative regulation of blood pressure ISS -
GO:0051898 negative regulation of protein kinase B signaling cascade ISS -
GO:0060134 prepulse inhibition ISS -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0030425 dendrite ISS neuron, axon, dendrite (GO term level: 6) -
GO:0030424 axon ISS neuron, axon, Neurotransmitter (GO term level: 6) -
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ADORA2A ADORA2 | RDC8 | hA2aR adenosine A2a receptor - HPRD,BioGRID 12804599
CLIC6 CLIC1L chloride intracellular channel 6 - HPRD,BioGRID 14499480
DRD2 D2DR | D2R dopamine receptor D2 D2S receptors form homodimers through Cys126 in the fourth transmembrane segment. BIND 12496294
EPB41 4.1R | EL1 | HE erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) - HPRD 12181426
EPB41L1 4.1N | DKFZp686H17242 | KIAA0338 | MGC11072 erythrocyte membrane protein band 4.1-like 1 - HPRD,BioGRID 12181426
FLNA ABP-280 | ABPX | DKFZp434P031 | FLN | FLN1 | FMD | MNS | NHBP | OPD | OPD1 | OPD2 filamin A, alpha (actin binding protein 280) Affinity Capture-Western BioGRID 12181426
FLNA ABP-280 | ABPX | DKFZp434P031 | FLN | FLN1 | FMD | MNS | NHBP | OPD | OPD1 | OPD2 filamin A, alpha (actin binding protein 280) Dopamine receptor D2 interacts with filamin A. This interaction was modeled on a demonstrated interaction between human FLN-A and D2 from unspecified source. BIND 11320256
FLNA ABP-280 | ABPX | DKFZp434P031 | FLN | FLN1 | FMD | MNS | NHBP | OPD | OPD1 | OPD2 filamin A, alpha (actin binding protein 280) - HPRD 11911837
FREQ DKFZp761L1223 | FLUP | NCS-1 | NCS1 frequenin homolog (Drosophila) - HPRD,BioGRID 12351722
FREQ DKFZp761L1223 | FLUP | NCS-1 | NCS1 frequenin homolog (Drosophila) The D2 dopamine receptor interacts with NCS-1. BIND 12351722
GNAI2 GIP | GNAI2B | H_LUCA15.1 | H_LUCA16.1 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 - HPRD 10978845
GNAI3 87U6 | FLJ26559 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 - HPRD 10978845
GNAZ - guanine nucleotide binding protein (G protein), alpha z polypeptide - HPRD 9166747
KCNJ3 GIRK1 | KGA | KIR3.1 potassium inwardly-rectifying channel, subfamily J, member 3 Affinity Capture-Western BioGRID 12297500
KCNJ5 CIR | GIRK4 | KATP1 | KIR3.4 potassium inwardly-rectifying channel, subfamily J, member 5 Affinity Capture-Western BioGRID 12297500
KCNJ6 BIR1 | GIRK2 | KATP2 | KCNJ7 | KIR3.2 | MGC126596 | hiGIRK2 potassium inwardly-rectifying channel, subfamily J, member 6 - HPRD,BioGRID 12297500
KCNJ9 GIRK3 | KIR3.3 potassium inwardly-rectifying channel, subfamily J, member 9 - HPRD 12297500
PPP1R9B FLJ30345 | PPP1R6 | PPP1R9 | SPINO | Spn protein phosphatase 1, regulatory (inhibitor) subunit 9B - HPRD,BioGRID 10391935
SSTR5 - somatostatin receptor 5 - HPRD 10753124


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION 272 195 All SZGR 2.0 genes in this pathway
KEGG GAP JUNCTION 90 68 All SZGR 2.0 genes in this pathway
BIOCARTA CK1 PATHWAY 17 17 All SZGR 2.0 genes in this pathway
ST G ALPHA I PATHWAY 35 29 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR 920 449 All SZGR 2.0 genes in this pathway
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS 305 177 All SZGR 2.0 genes in this pathway
REACTOME AMINE LIGAND BINDING RECEPTORS 38 33 All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING 805 368 All SZGR 2.0 genes in this pathway
REACTOME G ALPHA I SIGNALLING EVENTS 195 114 All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408 246 All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP 567 375 All SZGR 2.0 genes in this pathway
DEURIG T细胞PROLYMPHOCYTIC白血病 368 234 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS D UP 38 23 All SZGR 2.0 genes in this pathway
XU HGF TARGETS REPRESSED BY AKT1 DN 95 58 All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS DN 193 112 All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN 203 134 All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING VIA SMAD4 DN 66 38 All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS UP 92 64 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN 357 212 All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX UP 83 66 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE UP 95 64 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K27ME3 79 59 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341 243 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857 456 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-141/200a 128 134 m8 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
hsa-miR-200a UAACACUGUCUGGUAACGAUGU
miR-214 978 984 1A hsa-miR-214brain ACAGCAGGCACAGACAGGCAG
miR-326 527 534 1A,m8 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
miR-9 289 296 1A,m8 hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA