Gene Page:GIGYF2

Summary?
GeneID 26058
Symbol GIGYF2
Synonyms GYF2|PARK11|PERQ2|PERQ3|TNRC15
Description GRB10 interacting GYF protein 2
Reference MIM:612003|HGNC:HGNC:11960|Ensembl:ENSG00000204120|HPRD:11639|
Gene type protein-coding
Map location 2q37.1
Pascal p-value 5.268E-9
Sherlock p-value 0.556
Fetal beta 0.512

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWAScat Genome-wide Association Studies This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:PGC128 Genome-wide Association Study A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci
CV:PGCnp Genome-wide Association Study GWAS
LK:YES Genome-wide Association Study This data set included 99 genes mapped to the 22 regions. The 24 leading SNPs were also included in CV:Ripke_2013
Expression Meta-analysis of gene expression Pvalue: 1.654

Section I. Genetics and epigenetics annotation

@CV:PGC128

SNP ID Chromosome Position Allele P Function Gene Up/Down Distance
rs6704768 chr2 233592501 AG 3.148E-12 intronic GIGYF2


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding 新闻学会 16120600

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
THUM SYSTOLIC HEART FAILURE DN 244 147 All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER ADVANCED VS EARLY UP 175 120 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D DN 143 83 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537 339 All SZGR 2.0 genes in this pathway
TERAMOTO OPN TARGETS CLUSTER 5 7 5 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN 483 336 All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS UP 344 180 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514 330 All SZGR 2.0 genes in this pathway
阿塞维多了HYLATED IN LIVER CANCER DN 940 425 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP 149 85 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP 504 321 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D 882 506 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-143 185 191 1A hsa-miR-143brain UGAGAUGAAGCACUGUAGCUCA
hsa-miR-143brain UGAGAUGAAGCACUGUAGCUCA
miR-188 933 939 1A hsa-miR-188 CAUCCCUUGCAUGGUGGAGGGU
hsa-miR-188 CAUCCCUUGCAUGGUGGAGGGU
miR-30-3p 1063 1069 1A hsa-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3p CUUUCAGUCGGAUGUUUACAGC
miR-30-5p 1681 1688 1A,m8 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrain UGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZ UGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZ UGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5p UGUAAACAUCCUUGACUGGA
miR-330 1633 1639 m8 hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA
miR-485-3p 902 909 1A,m8 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU