Gene Page:GTDC1

Summary?
GeneID 79712
Symbol GTDC1
Synonyms Hmat-Xa|mat-Xa
Description glycosyltransferase like domain containing 1
Reference MIM:610165|HGNC:HGNC:20887|Ensembl:ENSG00000121964|HPRD:13615|Vega:OTTHUMG00000131835
Gene type protein-coding
Map location 2q22.3
Pascal p-value 0.006
Sherlock p-value 0.63
Fetal beta -0.013

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
GSMA_I Genome scan meta-analysis Psr: 0.023
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.02395

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
GDA 0.73 0.60
MYRIP 0.71 0.60
PTPRR 0.70 0.62
TRHDE 0.70 0.60
RP4-788L13.1 0.70 0.57
DLGAP2 0.70 0.60
CLOCK 0.69 0.56
NETO1 0.69 0.65
GRIN2A 0.69 0.55
GLRA3 0.68 0.55
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
NUDT8 -0.36 -0.37
BCL7C -0.33 -0.36
EMX2 -0.32 -0.41
NT5C -0.31 -0.31
ACP6 -0.31 -0.30
GRTP1 -0.31 -0.31
MUTYH -0.30 -0.32
AC132872.1 -0.30 -0.33
IMPA2 -0.30 -0.35
RDH5 -0.30 -0.22

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0016757 transferase activity, transferring glycosyl groups IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0009058 biosynthetic process IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
THUM SYSTOLIC HEART FAILURE UP 423 283 All SZGR 2.0 genes in this pathway
GRABARCZYK BCL11B TARGETS DN 57 35 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP 372 227 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 DN 242 165 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP 501 327 All SZGR 2.0 genes in this pathway
XU HGF TARGETS REPRESSED BY AKT1 DN 95 58 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024 594 All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP 412 249 All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3 491 310 All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING UP 93 62 All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN 306 191 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-129-5p 274 280 1A hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
miR-132/212 267 273 m8 hsa-miR-212SZ UAACAGUCUCCAGUCACGGCC
hsa-miR-132brain UAACAGUCUACAGCCAUGGUCG
miR-186 390 396 m8 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCUU
miR-381 294 300 1A hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
miR-383 75 81 1A hsa-miR-383brain AGAUCAGAAGGUGAUUGUGGCU
miR-490 470 477 1A,m8 hsa-miR-490 CAACCUGGAGGACUCCAUGCUG