Gene Page:KCNE4

Summary?
GeneID 23704
Symbol KCNE4
Synonyms MIRP3
Description potassium voltage-gated channel subfamily E regulatory subunit 4
Reference MIM:607775|HGNC:HGNC:6244|Ensembl:ENSG00000152049|HPRD:09689|Vega:OTTHUMG00000133161
Gene type protein-coding
Map location 2q36.1
Pascal p-value 0.772
Fetal beta -0.001
DMG 1 (# studies)
eGene Putamen basal ganglia
Support EXCITABILITY

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.01016
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00916

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg24742614 2 223917590 KCNE4 4.504E-4 0.349 0.045 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs13385347 2 224054346 KCNE4 ENSG00000152049.5 4.15301E-6 0.05 137814 gtex_brain_putamen_basal
rs10176552 2 224069500 KCNE4 ENSG00000152049.5 4.27074E-6 0.05 152968 gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005244 voltage-gated ion channel activity IEA -
GO:0005249 voltage-gated potassium channel activity IEA -
GO:0030955 potassium ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006811 ion transport IEA -
GO:0006813 potassium ion transport IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005856 cytoskeleton IDA 18029348
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -
GO:0043231 intracellular membrane-bounded organelle IDA 18029348

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
ONKEN UVEAL MELANOMA DN 526 357 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP 485 293 All SZGR 2.0 genes in this pathway
DOANE BREAST CANCER ESR1 UP 112 72 All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC 35 25 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 720 440 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP 439 257 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B UP 172 109 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701 446 All SZGR 2.0 genes in this pathway
IZADPANAH STEM CELL ADIPOSE VS BONE DN 108 68 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP 149 85 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857 456 All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP 259 159 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-30-3p 213 220 1A,m8 hsa-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3p CUUUCAGUCGGAUGUUUACAGC