Gene Page:PPP2R2B
Summary?
GeneID | 5521 |
Symbol | PPP2R2B |
Synonyms | B55BETA|PP2AB55BETA|PP2ABBETA|PP2APR55B|PP2APR55BETA|PR2AB55BETA|PR2ABBETA|PR2APR55BETA|PR52B|PR55-BETA|PR55BETA|SCA12 |
Description | protein phosphatase 2 regulatory subunit B, beta |
Reference | MIM:604325|HGNC:HGNC:9305|Ensembl:ENSG00000156475|HPRD:05059|Vega:OTTHUMG00000163381 |
Gene type | protein-coding |
Map location | 5q32 |
Pascal p-value | 5.413E-5 |
Sherlock p-value | 0.621 |
Fetal beta | 0.6 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00459 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01718 | |
Literature | High-throughput literature-search | 与精神分裂症Co-occurance关键词:schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PPP2R2B_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MPO | 0.81 | 0.21 |
PRTN3 | 0.67 | 0.08 |
ELANE | 0.62 | 0.08 |
KLK10 | 0.61 | 0.08 |
CBLN1 | 0.60 | 0.18 |
LMO1 | 0.60 | 0.11 |
ZNF385C | 0.57 | 0.20 |
RNASE2 | 0.56 | 0.22 |
UTF1 | 0.55 | -0.12 |
PODNL1 | 0.53 | 0.14 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
BCL2L2 | -0.20 | -0.32 |
ORAOV1 | -0.19 | -0.22 |
TRIM41 | -0.18 | -0.29 |
MAFK | -0.18 | -0.26 |
HDAC11 | -0.18 | -0.33 |
SEPT8 | -0.17 | -0.32 |
TCHH | -0.17 | -0.25 |
KLHL3 | -0.17 | -0.24 |
SYNM | -0.17 | -0.23 |
MAP7 | -0.17 | -0.32 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008601 | protein phosphatase type 2A regulator activity | TAS | 1849734 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0008219 | cell death | IEA | - | |
GO:0007165 | signal transduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000159 | protein phosphatase type 2A complex | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG TIGHT JUNCTION | 134 | 86 | All SZGR 2.0 genes in this pathway |
BIOCARTA CHREBP2 PATHWAY | 42 | 35 | All SZGR 2.0 genes in this pathway |
PID ATR PATHWAY | 39 | 25 | All SZGR 2.0 genes in this pathway |
PID PDGFRB PATHWAY | 129 | 103 | All SZGR 2.0 genes in this pathway |
HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D DN | 142 | 90 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS DN | 232 | 139 | All SZGR 2.0 genes in this pathway |
SENESE HDAC2 TARGETS DN | 133 | 77 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
ABBUD LIF SIGNALING 2 UP | 14 | 13 | All SZGR 2.0 genes in this pathway |
KANG IMMORTALIZED BY TERT DN | 102 | 67 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
LEIN MEDULLA MARKERS | 81 | 48 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY 4NQO OR UV | 63 | 44 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE DN | 195 | 135 | All SZGR 2.0 genes in this pathway |
ZHENG GLIOBLASTOMA PLASTICITY UP | 250 | 168 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
ISSAEVA MLL2 TARGETS | 62 | 35 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-129-5p | 412 | 418 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.