Gene Page:PRKAA1
Summary?
GeneID | 5562 |
Symbol | PRKAA1 |
Synonyms | AMPK|AMPKa1 |
Description | 蛋白质kinase AMP-activated catalytic subunit alpha 1 |
Reference | MIM:602739|HGNC:HGNC:9376|运用:ENSG00000132356|HPRD:04115|Vega:OTTHUMG00000162269 |
Gene type | protein-coding |
Map location | 5p12 |
Pascal p-value | 0.427 |
Fetal beta | 0.943 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
文学 | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.3086 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PRKAA1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NCAM2 | 0.89 | 0.87 |
WASL | 0.88 | 0.91 |
BAG4 | 0.87 | 0.88 |
SGIP1 | 0.86 | 0.88 |
CLOCK | 0.86 | 0.90 |
WDR7 | 0.86 | 0.87 |
DNAJB14 | 0.85 | 0.88 |
USP12 | 0.85 | 0.88 |
PREPL | 0.85 | 0.91 |
PCTK2 | 0.85 | 0.89 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AL022328.1 | -0.46 | -0.51 |
RP9P | -0.44 | -0.49 |
AC098691.2 | -0.42 | -0.44 |
RAB34 | -0.41 | -0.45 |
IRF7 | -0.41 | -0.48 |
C16orf79 | -0.41 | -0.41 |
NUDT8 | -0.40 | -0.42 |
C1orf61 | -0.40 | -0.47 |
BCL7C | -0.40 | -0.43 |
IL32 | -0.39 | -0.36 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0000287 | magnesium ion binding | IEA | - | |
GO:0005515 | protein binding | 新闻学会 | 18403135 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004674 | protein serine/threonine kinase activity | IEA | - | |
GO:0004691 | cAMP-dependent protein kinase activity | NAS | 8557660 | |
GO:0016740 | 转移酶的活动 | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000187 | activation of MAPK activity | NAS | 11546797 | |
GO:0001666 | 应对hypoxia | NAS | 8557660 | |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0007165 | signal transduction | TAS | 8557660 | |
GO:0006633 | fatty acid biosynthetic process | IEA | - | |
GO:0045768 | positive regulation of anti-apoptosis | NAS | 11165240 | |
GO:0045542 | positive regulation of cholesterol biosynthetic process | NAS | 8557660 | |
GO:0046318 | negative regulation of glucosylceramide biosynthetic process | NAS | 11165240 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IC | 8557660 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG REGULATION OF AUTOPHAGY | 35 | 30 | All SZGR 2.0 genes in this pathway |
KEGG MTOR SIGNALING PATHWAY | 52 | 40 | All SZGR 2.0 genes in this pathway |
KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
KEGG ADIPOCYTOKINE SIGNALING PATHWAY | 67 | 57 | All SZGR 2.0 genes in this pathway |
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM | 85 | 65 | All SZGR 2.0 genes in this pathway |
BIOCARTA CHREBP2 PATHWAY | 42 | 35 | All SZGR 2.0 genes in this pathway |
BIOCARTA LEPTIN PATHWAY | 11 | 11 | All SZGR 2.0 genes in this pathway |
PID LKB1 PATHWAY | 47 | 37 | All SZGR 2.0 genes in this pathway |
PID VEGFR1 2 PATHWAY | 69 | 57 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATED AMPK STIMULATES FATTY ACID OXIDATION IN MUSCLE | 19 | 16 | All SZGR 2.0 genes in this pathway |
REACTOME INSULIN RECEPTOR SIGNALLING CASCADE | 87 | 64 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF AMPK ACTIVITY VIA LKB1 | 15 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME ENERGY DEPENDENT REGULATION OF MTOR BY LKB1 AMPK | 18 | 15 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF RHEB GTPASE ACTIVITY BY AMPK | 10 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME PKB MEDIATED EVENTS | 29 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY INSULIN RECEPTOR | 108 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME PI3K CASCADE | 71 | 51 | All SZGR 2.0 genes in this pathway |
IGARASHI ATF4 TARGETS DN | 90 | 65 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
SAKAI CHRONIC HEPATITIS VS LIVER CANCER DN | 36 | 24 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
DE YY1 TARGETS DN | 92 | 64 | All SZGR 2.0 genes in this pathway |
FIRESTEIN PROLIFERATION | 175 | 125 | All SZGR 2.0 genes in this pathway |
HOFMANN MYELODYSPLASTIC SYNDROM HIGH RISK DN | 20 | 13 | All SZGR 2.0 genes in this pathway |
HOFMANN MYELODYSPLASTIC SYNDROM RISK DN | 23 | 12 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 2777 | 2784 | 1A,m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-130/301 | 2478 | 2484 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-144 | 2778 | 2784 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-148/152 | 2069 | 2076 | 1A,m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-153 | 2713 | 2719 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-19 | 123 | 130 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-30-3p | 2744 | 2750 | m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
miR-33 | 2650 | 2657 | 1A,m8 | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
miR-448 | 2713 | 2719 | 1A | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
miR-496 | 2818 | 2824 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-539 | 2847 | 2854 | 1A,m8 | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.