Gene Page:TRIM26
Summary?
GeneID | 7726 |
Symbol | TRIM26 |
Synonyms | AFP|RNF95|ZNF173 |
Description | tripartite motif containing 26 |
Reference | MIM:600830|HGNC:HGNC:12962|Ensembl:ENSG00000234127|HPRD:02901|Vega:OTTHUMG00000031041 |
Gene type | protein-coding |
Map location | 6p21.3 |
Pascal p-value | 1E-12 |
Sherlock p-value | 0.906 |
eGene | Caudate basal ganglia Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs7981812 | chr13 | 55312710 | TRIM26 | 7726 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/TRIM26_DE_GTEx.png)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ZNF615 | 0.96 | 0.96 |
ZFP112 | 0.95 | 0.95 |
RBM39 | 0.95 | 0.96 |
SNW1 | 0.94 | 0.93 |
SMC3 | 0.94 | 0.94 |
DDX46 | 0.94 | 0.94 |
RNF20 | 0.94 | 0.94 |
MYEF2 | 0.94 | 0.93 |
METAP2 | 0.94 | 0.93 |
SF3B1 | 0.94 | 0.94 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
IFI27 | -0.72 | -0.87 |
AF347015.31 | -0.72 | -0.84 |
MT-CO2 | -0.71 | -0.83 |
AF347015.27 | -0.71 | -0.82 |
HLA-F | -0.70 | -0.77 |
FXYD1 | -0.70 | -0.84 |
AF347015.33 | -0.69 | -0.81 |
PTH1R | -0.68 | -0.76 |
HIGD1B | -0.68 | -0.84 |
AIFM3 | -0.67 | -0.75 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003677 | DNA binding | TAS | 8530076 | |
GO:0005515 | protein binding | IEA | - | |
GO:0005515 | protein binding | TAS | 8530076 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
DER IFN ALPHA RESPONSE UP | 74 | 48 | All SZGR 2.0 genes in this pathway |
DER IFN BETA RESPONSE UP | 102 | 67 | All SZGR 2.0 genes in this pathway |
DER IFN GAMMA RESPONSE UP | 71 | 45 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
ZHU CMV ALL UP | 120 | 89 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C0 | 107 | 72 | All SZGR 2.0 genes in this pathway |
ZHU CMV 24 HR UP | 93 | 65 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 6HR UP | 71 | 48 | All SZGR 2.0 genes in this pathway |
ZHU CMV 8 HR UP | 47 | 39 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 | 317 | 177 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S2 | 115 | 74 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 1129 | 1135 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.